Incidental Mutation 'R5378:Hsfy2'
ID425657
Institutional Source Beutler Lab
Gene Symbol Hsfy2
Ensembl Gene ENSMUSG00000045336
Gene Nameheat shock transcription factor, Y-linked 2
Synonyms4933413G11Rik
MMRRC Submission 042953-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R5378 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location56636044-56637435 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56636668 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 237 (R237G)
Ref Sequence ENSEMBL: ENSMUSP00000049715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062085]
Predicted Effect probably benign
Transcript: ENSMUST00000062085
AA Change: R237G

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000049715
Gene: ENSMUSG00000045336
AA Change: R237G

DomainStartEndE-ValueType
HSF 76 194 6.55e-8 SMART
low complexity region 241 246 N/A INTRINSIC
low complexity region 343 362 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat T A 16: 8,578,277 F39L probably benign Het
Abca2 T G 2: 25,446,068 L2150R probably damaging Het
Apob T A 12: 8,011,865 V3449D probably damaging Het
Arfgef2 T A 2: 166,873,628 V1331D probably damaging Het
Bora A G 14: 99,068,493 N433D probably damaging Het
Cand2 G A 6: 115,801,951 A1159T probably benign Het
Ccser1 C T 6: 61,311,666 A271V probably benign Het
Ccser2 G A 14: 36,879,434 T331I possibly damaging Het
Cemip A G 7: 83,958,525 S758P probably damaging Het
Cenpf C T 1: 189,653,466 V2206I possibly damaging Het
Chrnb1 A T 11: 69,785,181 S412T probably benign Het
Cks1b A C 3: 89,416,301 W54G probably damaging Het
Col5a3 C T 9: 20,797,576 V630M unknown Het
Dnajb14 A G 3: 137,885,378 D30G probably benign Het
Dpp8 T C 9: 65,078,014 Y785H probably damaging Het
Dsel T A 1: 111,862,821 probably benign Het
Dzip1 C T 14: 118,911,393 M291I probably damaging Het
Esp8 G A 17: 40,530,142 C98Y unknown Het
F11 C A 8: 45,252,143 M120I probably benign Het
Fsip2 T C 2: 82,989,841 F5306S possibly damaging Het
Gm4841 T C 18: 60,271,041 probably null Het
Gpr180 T A 14: 118,139,839 L84Q probably benign Het
Grwd1 A T 7: 45,830,081 D123E probably benign Het
Htr5a A G 5: 27,850,995 Y328C probably damaging Het
Klrb1f G A 6: 129,053,831 A127T probably damaging Het
Mcpt4 A T 14: 56,062,293 probably null Het
Muc5b T C 7: 141,862,203 V2962A unknown Het
Olfr1095 A T 2: 86,851,463 N78K probably benign Het
Olfr601 T A 7: 103,358,445 I250F probably damaging Het
Otog A T 7: 46,255,004 T518S probably damaging Het
Phgdh A T 3: 98,321,323 probably null Het
Pip5kl1 A T 2: 32,579,094 T213S probably benign Het
Plekhg2 G A 7: 28,362,669 R594W probably damaging Het
Prg4 T A 1: 150,455,226 probably benign Het
Prpf40a T A 2: 53,145,876 D621V probably damaging Het
Ptprz1 A T 6: 23,007,402 I1655F probably damaging Het
Rbm28 T C 6: 29,128,559 K55E probably damaging Het
Rbm43 A T 2: 51,925,621 V196E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serinc4 T A 2: 121,452,380 M434L possibly damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc35f1 A T 10: 52,691,061 H22L possibly damaging Het
Smg6 A G 11: 75,041,994 D98G possibly damaging Het
Strbp A G 2: 37,599,174 Y527H probably damaging Het
Strbp A G 2: 37,600,806 V479A probably benign Het
Tcrg-C2 T C 13: 19,305,127 Y145C unknown Het
Tdg G T 10: 82,641,471 V119L probably benign Het
Trav10d G A 14: 52,811,368 R72H probably benign Het
Trim25 T C 11: 89,009,267 L280P probably damaging Het
Tsc22d4 A G 5: 137,762,464 D49G probably damaging Het
Ttn T C 2: 76,890,190 probably benign Het
Tyr T A 7: 87,472,495 H363L probably damaging Het
Ubr5 A G 15: 37,989,578 S2020P probably damaging Het
Usp9y T C Y: 1,315,928 D2069G probably damaging Het
Vmn1r170 T C 7: 23,606,538 W122R probably benign Het
Wdr7 G A 18: 63,825,239 probably null Het
Ylpm1 T A 12: 85,030,255 H793Q probably damaging Het
Zadh2 G A 18: 84,094,678 A160T probably damaging Het
Zfp266 G A 9: 20,499,363 T506I probably damaging Het
Zfp518a T C 19: 40,915,856 S1410P probably damaging Het
Other mutations in Hsfy2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1618:Hsfy2 UTSW 1 56637229 missense probably benign 0.41
R1670:Hsfy2 UTSW 1 56636389 missense possibly damaging 0.73
R1687:Hsfy2 UTSW 1 56636853 missense probably damaging 1.00
R1843:Hsfy2 UTSW 1 56636632 missense possibly damaging 0.84
R1954:Hsfy2 UTSW 1 56637183 missense probably benign 0.01
R2031:Hsfy2 UTSW 1 56636317 missense probably benign 0.18
R3117:Hsfy2 UTSW 1 56637106 missense probably damaging 1.00
R3778:Hsfy2 UTSW 1 56636688 missense possibly damaging 0.79
R4760:Hsfy2 UTSW 1 56637190 missense probably benign
R5065:Hsfy2 UTSW 1 56636467 nonsense probably null
R5192:Hsfy2 UTSW 1 56636735 missense probably benign 0.41
R6296:Hsfy2 UTSW 1 56637192 missense probably benign 0.00
R6474:Hsfy2 UTSW 1 56636991 missense probably damaging 0.97
R6813:Hsfy2 UTSW 1 56636302 missense possibly damaging 0.86
R6996:Hsfy2 UTSW 1 56636410 missense possibly damaging 0.53
R7486:Hsfy2 UTSW 1 56636971 nonsense probably null
R7609:Hsfy2 UTSW 1 56637151 missense probably benign 0.37
R7819:Hsfy2 UTSW 1 56636259 missense probably benign
R8208:Hsfy2 UTSW 1 56637151 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCACAGTGCTGTCGTTTGC -3'
(R):5'- ACTTTCTGAGAGACTGTCCCCATC -3'

Sequencing Primer
(F):5'- GACACCTCATTTAATGGAGCAGGC -3'
(R):5'- GAGAGACTGTCCCCATCTTATAG -3'
Posted On2016-08-04