Incidental Mutation 'R5378:Prg4'
ID425662
Institutional Source Beutler Lab
Gene Symbol Prg4
Ensembl Gene ENSMUSG00000006014
Gene Nameproteoglycan 4 (megakaryocyte stimulating factor, articular superficial zone protein)
SynonymsDOL54, SZP, lubricin, MSF
MMRRC Submission 042953-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R5378 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location150449412-150466165 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 150455226 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006171] [ENSMUST00000111901] [ENSMUST00000111902] [ENSMUST00000159035] [ENSMUST00000161320] [ENSMUST00000161611] [ENSMUST00000162367] [ENSMUST00000164600]
Predicted Effect probably benign
Transcript: ENSMUST00000006171
SMART Domains Protein: ENSMUSP00000006171
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 4.21e-12 SMART
low complexity region 110 124 N/A INTRINSIC
HX 169 211 1.67e-7 SMART
HX 213 256 3.76e-10 SMART
Blast:HX 369 422 2e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111901
SMART Domains Protein: ENSMUSP00000107532
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 4.21e-12 SMART
low complexity region 110 124 N/A INTRINSIC
low complexity region 141 151 N/A INTRINSIC
low complexity region 189 221 N/A INTRINSIC
low complexity region 241 535 N/A INTRINSIC
low complexity region 570 623 N/A INTRINSIC
HX 711 753 1.67e-7 SMART
HX 755 798 3.76e-10 SMART
Blast:HX 911 964 5e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111902
SMART Domains Protein: ENSMUSP00000107533
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 25 67 2.71e-15 SMART
low complexity region 69 81 N/A INTRINSIC
low complexity region 86 143 N/A INTRINSIC
low complexity region 150 171 N/A INTRINSIC
low complexity region 188 198 N/A INTRINSIC
low complexity region 236 268 N/A INTRINSIC
low complexity region 288 582 N/A INTRINSIC
internal_repeat_1 588 614 2.72e-5 PROSPERO
low complexity region 617 670 N/A INTRINSIC
internal_repeat_1 680 706 2.72e-5 PROSPERO
HX 758 800 1.67e-7 SMART
HX 802 845 3.76e-10 SMART
Blast:HX 958 1011 4e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159035
SMART Domains Protein: ENSMUSP00000124410
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 25 67 2.71e-15 SMART
low complexity region 69 81 N/A INTRINSIC
low complexity region 88 99 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161320
SMART Domains Protein: ENSMUSP00000124801
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 25 67 3.83e-15 SMART
low complexity region 69 83 N/A INTRINSIC
low complexity region 100 110 N/A INTRINSIC
low complexity region 148 179 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161611
AA Change: E565D
SMART Domains Protein: ENSMUSP00000125677
Gene: ENSMUSG00000006014
AA Change: E565D

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 2.77e-12 SMART
low complexity region 110 122 N/A INTRINSIC
low complexity region 127 184 N/A INTRINSIC
low complexity region 191 212 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
internal_repeat_3 244 271 7.42e-5 PROSPERO
low complexity region 277 309 N/A INTRINSIC
Pfam:Cornifin 578 691 2.2e-9 PFAM
internal_repeat_3 796 825 7.42e-5 PROSPERO
internal_repeat_2 797 823 1.24e-5 PROSPERO
low complexity region 826 879 N/A INTRINSIC
internal_repeat_2 889 915 1.24e-5 PROSPERO
HX 967 1009 1.67e-7 SMART
HX 1011 1054 3.76e-10 SMART
Blast:HX 1167 1220 6e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162367
SMART Domains Protein: ENSMUSP00000125551
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 4.21e-12 SMART
low complexity region 110 124 N/A INTRINSIC
HX 169 211 1.67e-7 SMART
HX 213 256 3.76e-10 SMART
Blast:HX 369 422 2e-27 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000164600
AA Change: E565D
SMART Domains Protein: ENSMUSP00000128943
Gene: ENSMUSG00000006014
AA Change: E565D

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 2.77e-12 SMART
low complexity region 110 122 N/A INTRINSIC
low complexity region 127 184 N/A INTRINSIC
low complexity region 191 212 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
internal_repeat_3 244 271 7.42e-5 PROSPERO
low complexity region 277 309 N/A INTRINSIC
Pfam:Cornifin 404 497 2.4e-14 PFAM
Pfam:Cornifin 468 584 3.2e-15 PFAM
Pfam:Cornifin 550 648 3.3e-16 PFAM
Pfam:Cornifin 625 722 2.1e-15 PFAM
Pfam:Cornifin 647 743 7.8e-16 PFAM
Pfam:Cornifin 706 822 1.4e-12 PFAM
low complexity region 826 879 N/A INTRINSIC
internal_repeat_2 889 915 1.24e-5 PROSPERO
HX 967 1009 1.67e-7 SMART
HX 1011 1054 3.76e-10 SMART
Blast:HX 1167 1220 6e-27 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Aging homozygous null mice develop a hopping gait, irregular endochondral growth plates, altered cartilage surface, camptodactyly, progressive synovial hyperplasia and, ultimately, joint failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat T A 16: 8,578,277 F39L probably benign Het
Abca2 T G 2: 25,446,068 L2150R probably damaging Het
Apob T A 12: 8,011,865 V3449D probably damaging Het
Arfgef2 T A 2: 166,873,628 V1331D probably damaging Het
Bora A G 14: 99,068,493 N433D probably damaging Het
Cand2 G A 6: 115,801,951 A1159T probably benign Het
Ccser1 C T 6: 61,311,666 A271V probably benign Het
Ccser2 G A 14: 36,879,434 T331I possibly damaging Het
Cemip A G 7: 83,958,525 S758P probably damaging Het
Cenpf C T 1: 189,653,466 V2206I possibly damaging Het
Chrnb1 A T 11: 69,785,181 S412T probably benign Het
Cks1b A C 3: 89,416,301 W54G probably damaging Het
Col5a3 C T 9: 20,797,576 V630M unknown Het
Dnajb14 A G 3: 137,885,378 D30G probably benign Het
Dpp8 T C 9: 65,078,014 Y785H probably damaging Het
Dsel T A 1: 111,862,821 probably benign Het
Dzip1 C T 14: 118,911,393 M291I probably damaging Het
Esp8 G A 17: 40,530,142 C98Y unknown Het
F11 C A 8: 45,252,143 M120I probably benign Het
Fsip2 T C 2: 82,989,841 F5306S possibly damaging Het
Gm4841 T C 18: 60,271,041 probably null Het
Gpr180 T A 14: 118,139,839 L84Q probably benign Het
Grwd1 A T 7: 45,830,081 D123E probably benign Het
Hsfy2 T C 1: 56,636,668 R237G probably benign Het
Htr5a A G 5: 27,850,995 Y328C probably damaging Het
Klrb1f G A 6: 129,053,831 A127T probably damaging Het
Mcpt4 A T 14: 56,062,293 probably null Het
Muc5b T C 7: 141,862,203 V2962A unknown Het
Olfr1095 A T 2: 86,851,463 N78K probably benign Het
Olfr601 T A 7: 103,358,445 I250F probably damaging Het
Otog A T 7: 46,255,004 T518S probably damaging Het
Phgdh A T 3: 98,321,323 probably null Het
Pip5kl1 A T 2: 32,579,094 T213S probably benign Het
Plekhg2 G A 7: 28,362,669 R594W probably damaging Het
Prpf40a T A 2: 53,145,876 D621V probably damaging Het
Ptprz1 A T 6: 23,007,402 I1655F probably damaging Het
Rbm28 T C 6: 29,128,559 K55E probably damaging Het
Rbm43 A T 2: 51,925,621 V196E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serinc4 T A 2: 121,452,380 M434L possibly damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc35f1 A T 10: 52,691,061 H22L possibly damaging Het
Smg6 A G 11: 75,041,994 D98G possibly damaging Het
Strbp A G 2: 37,599,174 Y527H probably damaging Het
Strbp A G 2: 37,600,806 V479A probably benign Het
Tcrg-C2 T C 13: 19,305,127 Y145C unknown Het
Tdg G T 10: 82,641,471 V119L probably benign Het
Trav10d G A 14: 52,811,368 R72H probably benign Het
Trim25 T C 11: 89,009,267 L280P probably damaging Het
Tsc22d4 A G 5: 137,762,464 D49G probably damaging Het
Ttn T C 2: 76,890,190 probably benign Het
Tyr T A 7: 87,472,495 H363L probably damaging Het
Ubr5 A G 15: 37,989,578 S2020P probably damaging Het
Usp9y T C Y: 1,315,928 D2069G probably damaging Het
Vmn1r170 T C 7: 23,606,538 W122R probably benign Het
Wdr7 G A 18: 63,825,239 probably null Het
Ylpm1 T A 12: 85,030,255 H793Q probably damaging Het
Zadh2 G A 18: 84,094,678 A160T probably damaging Het
Zfp266 G A 9: 20,499,363 T506I probably damaging Het
Zfp518a T C 19: 40,915,856 S1410P probably damaging Het
Other mutations in Prg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Prg4 APN 1 150451920 missense probably damaging 0.99
IGL02033:Prg4 APN 1 150455868 intron probably benign
IGL02154:Prg4 APN 1 150454862 intron probably benign
IGL03111:Prg4 APN 1 150451902 missense probably benign 0.06
IGL03177:Prg4 APN 1 150455603 intron probably benign
IGL03260:Prg4 APN 1 150455627 intron probably benign
IGL03281:Prg4 APN 1 150450088 splice site probably benign
R0046:Prg4 UTSW 1 150456086 missense possibly damaging 0.53
R0046:Prg4 UTSW 1 150456086 missense possibly damaging 0.53
R0196:Prg4 UTSW 1 150454492 intron probably benign
R0233:Prg4 UTSW 1 150453547 splice site probably benign
R0255:Prg4 UTSW 1 150455807 intron probably benign
R0616:Prg4 UTSW 1 150460711 missense probably damaging 1.00
R1016:Prg4 UTSW 1 150454691 intron probably benign
R1826:Prg4 UTSW 1 150452009 missense probably benign 0.09
R1862:Prg4 UTSW 1 150460669 missense probably damaging 0.99
R1863:Prg4 UTSW 1 150460669 missense probably damaging 0.99
R1922:Prg4 UTSW 1 150449999 nonsense probably null
R1940:Prg4 UTSW 1 150456023 missense possibly damaging 0.53
R3765:Prg4 UTSW 1 150451371 missense probably damaging 0.97
R3855:Prg4 UTSW 1 150452000 missense probably damaging 1.00
R3894:Prg4 UTSW 1 150454759 intron probably benign
R3895:Prg4 UTSW 1 150454759 intron probably benign
R3912:Prg4 UTSW 1 150451868 missense probably damaging 1.00
R3935:Prg4 UTSW 1 150458157 missense possibly damaging 0.68
R4050:Prg4 UTSW 1 150454759 intron probably benign
R4475:Prg4 UTSW 1 150454859 intron probably benign
R4794:Prg4 UTSW 1 150454546 intron probably benign
R4910:Prg4 UTSW 1 150455823 intron probably benign
R4911:Prg4 UTSW 1 150455823 intron probably benign
R4993:Prg4 UTSW 1 150460681 missense probably damaging 1.00
R5381:Prg4 UTSW 1 150454453 intron probably benign
R5452:Prg4 UTSW 1 150455768 intron probably benign
R5870:Prg4 UTSW 1 150455549 nonsense probably null
R5888:Prg4 UTSW 1 150452350 missense probably damaging 1.00
R5929:Prg4 UTSW 1 150454129 missense probably benign 0.01
R6058:Prg4 UTSW 1 150451446 missense probably damaging 0.99
R6059:Prg4 UTSW 1 150449997 missense possibly damaging 0.67
R6232:Prg4 UTSW 1 150455816 intron probably benign
R6272:Prg4 UTSW 1 150454766 intron probably benign
R6459:Prg4 UTSW 1 150454301 intron probably benign
R6659:Prg4 UTSW 1 150460681 missense probably damaging 1.00
R6663:Prg4 UTSW 1 150455101 intron probably benign
R6882:Prg4 UTSW 1 150453495 missense probably damaging 1.00
R6970:Prg4 UTSW 1 150455906 intron probably benign
R7078:Prg4 UTSW 1 150458263 missense possibly damaging 0.91
R7102:Prg4 UTSW 1 150452254 missense probably damaging 1.00
R7264:Prg4 UTSW 1 150454067 missense not run
R7487:Prg4 UTSW 1 150455905 missense unknown
R7531:Prg4 UTSW 1 150455035 missense unknown
R7651:Prg4 UTSW 1 150454945 missense unknown
R7701:Prg4 UTSW 1 150457542 missense possibly damaging 0.53
X0024:Prg4 UTSW 1 150454492 intron probably benign
Predicted Primers PCR Primer
(F):5'- GTAGGTTCAGGCTCCTTGAG -3'
(R):5'- CACCACTCTCAAGGAGCCTG -3'

Sequencing Primer
(F):5'- TCAGGCTCCTTGAGAGTGG -3'
(R):5'- TCTCAAGGAGCCTGAACCC -3'
Posted On2016-08-04