Incidental Mutation 'R5378:Pip5kl1'
ID425666
Institutional Source Beutler Lab
Gene Symbol Pip5kl1
Ensembl Gene ENSMUSG00000046854
Gene Namephosphatidylinositol-4-phosphate 5-kinase-like 1
Synonyms
MMRRC Submission 042953-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R5378 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location32574797-32583782 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32579094 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 213 (T213S)
Ref Sequence ENSEMBL: ENSMUSP00000051282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055304] [ENSMUST00000100188] [ENSMUST00000100190]
Predicted Effect probably benign
Transcript: ENSMUST00000055304
AA Change: T213S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000051282
Gene: ENSMUSG00000046854
AA Change: T213S

DomainStartEndE-ValueType
Pfam:PIP5K 127 393 4.2e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100188
AA Change: T255S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000097763
Gene: ENSMUSG00000046854
AA Change: T255S

DomainStartEndE-ValueType
Pfam:PIP5K 165 358 4.3e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134204
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PIP5KL1 is a phosphoinositide kinase-like protein that lacks intrinsic lipid kinase activity but associates with type I PIPKs (see PIP5K1A; MIM 603275) and may play a role in localization of PIPK activity (Chang et al., 2004 [PubMed 14701839]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat T A 16: 8,578,277 F39L probably benign Het
Abca2 T G 2: 25,446,068 L2150R probably damaging Het
Apob T A 12: 8,011,865 V3449D probably damaging Het
Arfgef2 T A 2: 166,873,628 V1331D probably damaging Het
Bora A G 14: 99,068,493 N433D probably damaging Het
Cand2 G A 6: 115,801,951 A1159T probably benign Het
Ccser1 C T 6: 61,311,666 A271V probably benign Het
Ccser2 G A 14: 36,879,434 T331I possibly damaging Het
Cemip A G 7: 83,958,525 S758P probably damaging Het
Cenpf C T 1: 189,653,466 V2206I possibly damaging Het
Chrnb1 A T 11: 69,785,181 S412T probably benign Het
Cks1b A C 3: 89,416,301 W54G probably damaging Het
Col5a3 C T 9: 20,797,576 V630M unknown Het
Dnajb14 A G 3: 137,885,378 D30G probably benign Het
Dpp8 T C 9: 65,078,014 Y785H probably damaging Het
Dsel T A 1: 111,862,821 probably benign Het
Dzip1 C T 14: 118,911,393 M291I probably damaging Het
Esp8 G A 17: 40,530,142 C98Y unknown Het
F11 C A 8: 45,252,143 M120I probably benign Het
Fsip2 T C 2: 82,989,841 F5306S possibly damaging Het
Gm4841 T C 18: 60,271,041 probably null Het
Gpr180 T A 14: 118,139,839 L84Q probably benign Het
Grwd1 A T 7: 45,830,081 D123E probably benign Het
Hsfy2 T C 1: 56,636,668 R237G probably benign Het
Htr5a A G 5: 27,850,995 Y328C probably damaging Het
Klrb1f G A 6: 129,053,831 A127T probably damaging Het
Mcpt4 A T 14: 56,062,293 probably null Het
Muc5b T C 7: 141,862,203 V2962A unknown Het
Olfr1095 A T 2: 86,851,463 N78K probably benign Het
Olfr601 T A 7: 103,358,445 I250F probably damaging Het
Otog A T 7: 46,255,004 T518S probably damaging Het
Phgdh A T 3: 98,321,323 probably null Het
Plekhg2 G A 7: 28,362,669 R594W probably damaging Het
Prg4 T A 1: 150,455,226 probably benign Het
Prpf40a T A 2: 53,145,876 D621V probably damaging Het
Ptprz1 A T 6: 23,007,402 I1655F probably damaging Het
Rbm28 T C 6: 29,128,559 K55E probably damaging Het
Rbm43 A T 2: 51,925,621 V196E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serinc4 T A 2: 121,452,380 M434L possibly damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc35f1 A T 10: 52,691,061 H22L possibly damaging Het
Smg6 A G 11: 75,041,994 D98G possibly damaging Het
Strbp A G 2: 37,599,174 Y527H probably damaging Het
Strbp A G 2: 37,600,806 V479A probably benign Het
Tcrg-C2 T C 13: 19,305,127 Y145C unknown Het
Tdg G T 10: 82,641,471 V119L probably benign Het
Trav10d G A 14: 52,811,368 R72H probably benign Het
Trim25 T C 11: 89,009,267 L280P probably damaging Het
Tsc22d4 A G 5: 137,762,464 D49G probably damaging Het
Ttn T C 2: 76,890,190 probably benign Het
Tyr T A 7: 87,472,495 H363L probably damaging Het
Ubr5 A G 15: 37,989,578 S2020P probably damaging Het
Usp9y T C Y: 1,315,928 D2069G probably damaging Het
Vmn1r170 T C 7: 23,606,538 W122R probably benign Het
Wdr7 G A 18: 63,825,239 probably null Het
Ylpm1 T A 12: 85,030,255 H793Q probably damaging Het
Zadh2 G A 18: 84,094,678 A160T probably damaging Het
Zfp266 G A 9: 20,499,363 T506I probably damaging Het
Zfp518a T C 19: 40,915,856 S1410P probably damaging Het
Other mutations in Pip5kl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Pip5kl1 APN 2 32583347 missense probably benign 0.12
IGL03074:Pip5kl1 APN 2 32580341 missense probably damaging 0.97
IGL03115:Pip5kl1 APN 2 32580021 missense probably damaging 1.00
IGL03235:Pip5kl1 APN 2 32578154 missense probably damaging 0.99
PIT4280001:Pip5kl1 UTSW 2 32583458 missense probably benign 0.06
R0149:Pip5kl1 UTSW 2 32578954 missense possibly damaging 0.70
R0416:Pip5kl1 UTSW 2 32583424 nonsense probably null
R1500:Pip5kl1 UTSW 2 32576679 missense probably benign 0.38
R1887:Pip5kl1 UTSW 2 32578505 missense probably damaging 1.00
R2897:Pip5kl1 UTSW 2 32583347 missense probably benign 0.12
R3824:Pip5kl1 UTSW 2 32583271 unclassified probably null
R3937:Pip5kl1 UTSW 2 32579112 missense probably damaging 1.00
R7257:Pip5kl1 UTSW 2 32580431 critical splice donor site probably null
R7414:Pip5kl1 UTSW 2 32578235 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CGTCTTTCAGGCGTATACAGTC -3'
(R):5'- TCTGGACTACGGAGACTATTTCAATC -3'

Sequencing Primer
(F):5'- TCAGGCGTATACAGTCTGCGG -3'
(R):5'- TGAGCCTAGCCTGTACGAAAGC -3'
Posted On2016-08-04