Incidental Mutation 'R5378:Grwd1'
ID425691
Institutional Source Beutler Lab
Gene Symbol Grwd1
Ensembl Gene ENSMUSG00000053801
Gene Nameglutamate-rich WD repeat containing 1
SynonymsWDR28
MMRRC Submission 042953-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R5378 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45825223-45830944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45830081 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 123 (D123E)
Ref Sequence ENSEMBL: ENSMUSP00000116252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002848] [ENSMUST00000107723] [ENSMUST00000131384] [ENSMUST00000209484] [ENSMUST00000211265] [ENSMUST00000211713]
Predicted Effect probably benign
Transcript: ENSMUST00000002848
SMART Domains Protein: ENSMUSP00000002848
Gene: ENSMUSG00000002771

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 47 N/A INTRINSIC
low complexity region 60 73 N/A INTRINSIC
Pfam:ANF_receptor 89 330 1.7e-12 PFAM
PBPe 428 823 4.11e-65 SMART
Lig_chan-Glu_bd 471 527 7.88e-18 SMART
transmembrane domain 843 862 N/A INTRINSIC
low complexity region 896 931 N/A INTRINSIC
low complexity region 932 943 N/A INTRINSIC
low complexity region 969 1001 N/A INTRINSIC
low complexity region 1011 1039 N/A INTRINSIC
low complexity region 1065 1091 N/A INTRINSIC
low complexity region 1095 1120 N/A INTRINSIC
low complexity region 1192 1247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107723
AA Change: D123E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000103351
Gene: ENSMUSG00000053801
AA Change: D123E

DomainStartEndE-ValueType
Pfam:CAF1C_H4-bd 42 113 8.6e-18 PFAM
low complexity region 123 136 N/A INTRINSIC
Blast:WD40 138 179 1e-18 BLAST
WD40 203 243 1.58e-2 SMART
WD40 249 290 5.47e-6 SMART
WD40 297 336 2.22e-6 SMART
WD40 342 382 2.59e-7 SMART
Blast:WD40 404 442 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131384
AA Change: D123E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000116252
Gene: ENSMUSG00000053801
AA Change: D123E

DomainStartEndE-ValueType
Pfam:CAF1C_H4-bd 44 112 2.7e-15 PFAM
low complexity region 123 136 N/A INTRINSIC
Blast:WD40 138 179 1e-18 BLAST
WD40 203 243 1.58e-2 SMART
WD40 249 290 5.47e-6 SMART
WD40 297 336 2.22e-6 SMART
WD40 342 382 2.59e-7 SMART
Blast:WD40 404 442 1e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209301
Predicted Effect probably benign
Transcript: ENSMUST00000209484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210177
Predicted Effect probably benign
Transcript: ENSMUST00000211265
Predicted Effect probably benign
Transcript: ENSMUST00000211713
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glutamate-rich protein that contains five WD-repeat motifs. The encoded protein may play a critical role in ribosome biogenesis and may also play a role in histone methylation through interactions with CUL4-DDB1 ubiquitin E3 ligase. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat T A 16: 8,578,277 F39L probably benign Het
Abca2 T G 2: 25,446,068 L2150R probably damaging Het
Apob T A 12: 8,011,865 V3449D probably damaging Het
Arfgef2 T A 2: 166,873,628 V1331D probably damaging Het
Bora A G 14: 99,068,493 N433D probably damaging Het
Cand2 G A 6: 115,801,951 A1159T probably benign Het
Ccser1 C T 6: 61,311,666 A271V probably benign Het
Ccser2 G A 14: 36,879,434 T331I possibly damaging Het
Cemip A G 7: 83,958,525 S758P probably damaging Het
Cenpf C T 1: 189,653,466 V2206I possibly damaging Het
Chrnb1 A T 11: 69,785,181 S412T probably benign Het
Cks1b A C 3: 89,416,301 W54G probably damaging Het
Col5a3 C T 9: 20,797,576 V630M unknown Het
Dnajb14 A G 3: 137,885,378 D30G probably benign Het
Dpp8 T C 9: 65,078,014 Y785H probably damaging Het
Dsel T A 1: 111,862,821 probably benign Het
Dzip1 C T 14: 118,911,393 M291I probably damaging Het
Esp8 G A 17: 40,530,142 C98Y unknown Het
F11 C A 8: 45,252,143 M120I probably benign Het
Fsip2 T C 2: 82,989,841 F5306S possibly damaging Het
Gm4841 T C 18: 60,271,041 probably null Het
Gpr180 T A 14: 118,139,839 L84Q probably benign Het
Hsfy2 T C 1: 56,636,668 R237G probably benign Het
Htr5a A G 5: 27,850,995 Y328C probably damaging Het
Klrb1f G A 6: 129,053,831 A127T probably damaging Het
Mcpt4 A T 14: 56,062,293 probably null Het
Muc5b T C 7: 141,862,203 V2962A unknown Het
Olfr1095 A T 2: 86,851,463 N78K probably benign Het
Olfr601 T A 7: 103,358,445 I250F probably damaging Het
Otog A T 7: 46,255,004 T518S probably damaging Het
Phgdh A T 3: 98,321,323 probably null Het
Pip5kl1 A T 2: 32,579,094 T213S probably benign Het
Plekhg2 G A 7: 28,362,669 R594W probably damaging Het
Prg4 T A 1: 150,455,226 probably benign Het
Prpf40a T A 2: 53,145,876 D621V probably damaging Het
Ptprz1 A T 6: 23,007,402 I1655F probably damaging Het
Rbm28 T C 6: 29,128,559 K55E probably damaging Het
Rbm43 A T 2: 51,925,621 V196E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serinc4 T A 2: 121,452,380 M434L possibly damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc35f1 A T 10: 52,691,061 H22L possibly damaging Het
Smg6 A G 11: 75,041,994 D98G possibly damaging Het
Strbp A G 2: 37,599,174 Y527H probably damaging Het
Strbp A G 2: 37,600,806 V479A probably benign Het
Tcrg-C2 T C 13: 19,305,127 Y145C unknown Het
Tdg G T 10: 82,641,471 V119L probably benign Het
Trav10d G A 14: 52,811,368 R72H probably benign Het
Trim25 T C 11: 89,009,267 L280P probably damaging Het
Tsc22d4 A G 5: 137,762,464 D49G probably damaging Het
Ttn T C 2: 76,890,190 probably benign Het
Tyr T A 7: 87,472,495 H363L probably damaging Het
Ubr5 A G 15: 37,989,578 S2020P probably damaging Het
Usp9y T C Y: 1,315,928 D2069G probably damaging Het
Vmn1r170 T C 7: 23,606,538 W122R probably benign Het
Wdr7 G A 18: 63,825,239 probably null Het
Ylpm1 T A 12: 85,030,255 H793Q probably damaging Het
Zadh2 G A 18: 84,094,678 A160T probably damaging Het
Zfp266 G A 9: 20,499,363 T506I probably damaging Het
Zfp518a T C 19: 40,915,856 S1410P probably damaging Het
Other mutations in Grwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Grwd1 APN 7 45830613 missense probably damaging 1.00
IGL01443:Grwd1 APN 7 45830410 critical splice acceptor site probably null
IGL01459:Grwd1 APN 7 45830410 critical splice acceptor site probably null
IGL02139:Grwd1 APN 7 45827243 missense probably damaging 1.00
IGL03009:Grwd1 APN 7 45827137 splice site probably benign
R0178:Grwd1 UTSW 7 45830630 missense probably damaging 1.00
R0334:Grwd1 UTSW 7 45827177 unclassified probably null
R4392:Grwd1 UTSW 7 45827780 missense probably damaging 1.00
R5133:Grwd1 UTSW 7 45825874 missense probably benign 0.27
R5146:Grwd1 UTSW 7 45827834 missense probably damaging 1.00
R5554:Grwd1 UTSW 7 45830640 missense probably damaging 1.00
R7177:Grwd1 UTSW 7 45830780 start codon destroyed probably null 0.77
Predicted Primers PCR Primer
(F):5'- CTGAGAGACATTTGGATCTAGGGG -3'
(R):5'- CAGTCTTTACCTGTGTGCGG -3'

Sequencing Primer
(F):5'- ACATTTGGATCTAGGGGGAGGG -3'
(R):5'- TAGGTGAGACCCAGGACCTTTG -3'
Posted On2016-08-04