Mutagenetix > Incidental Mutations

Incidental Mutation 'R5379:Rnf20'

425735

Institutional Source

Beutler Lab

Gene Symbol

Rnf20

Ensembl Gene

ENSMUSG00000028309

Gene Name

ring finger protein 20

Synonyms

4833430L21Rik

MMRRC Submission

042954-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5379 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

49632006-49656887 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 49652639 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 711 (Y711N)

Ref Sequence

ENSEMBL: ENSMUSP00000128546 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029989] [ENSMUST00000156314] [ENSMUST00000167496]

AlphaFold

Q5DTM8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029989
AA Change: Y711N

PolyPhen 2 Score 0.465 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000029989
Gene: ENSMUSG00000028309
AA Change: Y711N

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
coiled coil region	172	200	N/A	INTRINSIC
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	733	N/A	INTRINSIC
coiled coil region	769	805	N/A	INTRINSIC
coiled coil region	828	867	N/A	INTRINSIC
RING	920	958	2e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131962

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138490

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149862

Predicted Effect

probably benign
Transcript: ENSMUST00000156314

SMART Domains

Protein: ENSMUSP00000118293
Gene: ENSMUSG00000028309

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
low complexity region	164	172	N/A	INTRINSIC
SCOP:d1gw5a_	174	294	3e-3	SMART
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	606	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167496
AA Change: Y711N

PolyPhen 2 Score 0.465 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000128546
Gene: ENSMUSG00000028309
AA Change: Y711N

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
coiled coil region	172	200	N/A	INTRINSIC
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	733	N/A	INTRINSIC
coiled coil region	769	805	N/A	INTRINSIC
coiled coil region	828	867	N/A	INTRINSIC
RING	920	958	2e-4	SMART

Meta Mutation Damage Score

0.0661

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

97% (58/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with BRE1 of S. cerevisiae. The protein encoded by this human gene is an E3 ubiquitin ligase that regulates chromosome structure by monoubiquitinating histone H2B. This protein acts as a putative tumor suppressor and positively regulates the p53 tumor suppressor as well as numerous histone H2A and H2B genes. In contrast, this protein also suppresses the expression of several protooncogenes and growth-related genes, including many genes that are induced by epidermal growth factor. This gene selectively suppresses the expression of some genes by interfering with chromatin recruitment of transcription elongation factor SII (TFIIS). [provided by RefSeq, Feb 2012]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy1	T	A	11: 7,146,532	L640Q	probably damaging	Het
Afap1l1	T	C	18: 61,758,650	E32G	probably damaging	Het
Atp1a1	T	A	3: 101,582,095	M734L	probably benign	Het
B4galt6	T	C	18: 20,689,239	D294G	probably damaging	Het
Baz1a	T	G	12: 54,894,348	D1539A	probably damaging	Het
Bmper	T	A	9: 23,297,224	S141T	probably benign	Het
Camkv	T	C	9: 107,945,346	V20A	probably damaging	Het
Chst8	A	G	7: 34,675,854	Y187H	probably damaging	Het
Coro1c	A	G	5: 113,845,382	Y362H	probably damaging	Het
Csmd3	C	A	15: 47,636,450	G3008*	probably null	Het
Dnah17	T	C	11: 118,117,203		probably benign	Het
Dnajb1	C	T	8: 83,608,506	R59C	possibly damaging	Het
Dpf1	A	G	7: 29,304,108	K10E	probably benign	Het
Eif5	T	C	12: 111,543,555	L311P	probably damaging	Het
Eqtn	A	G	4: 94,907,588	F251S	probably damaging	Het
Fam208b	T	C	13: 3,588,496	R412G	probably benign	Het
Fancg	A	G	4: 43,002,998	S620P	probably benign	Het
Farp1	T	C	14: 121,256,757	V550A	possibly damaging	Het
Fat2	T	C	11: 55,303,941	T1091A	probably damaging	Het
Fbxo33	A	G	12: 59,219,460		probably benign	Het
Fndc5	A	T	4: 129,142,094	I175F	probably damaging	Het
Gm13023	A	G	4: 143,794,923	I370V	probably benign	Het
Gtf2ird2	G	C	5: 134,217,468	R856P	probably benign	Het
Hc	A	T	2: 34,991,065	F1481I	probably damaging	Het
Helz2	T	A	2: 181,235,069	T1211S	probably benign	Het
Hmcn2	G	A	2: 31,409,011	V2790M	probably damaging	Het
Ighv1-82	T	C	12: 115,952,677	Y71C	probably damaging	Het
Itgam	A	G	7: 128,112,388	D725G	probably damaging	Het
Kif9	T	C	9: 110,521,303	V754A	probably benign	Het
Larp4b	C	A	13: 9,136,909	T91K	probably benign	Het
Mki67	T	C	7: 135,697,461	E1948G	possibly damaging	Het
Mllt6	G	A	11: 97,669,500	S210N	possibly damaging	Het
Mrgprb13	A	T	7: 48,311,748		noncoding transcript	Het
Nlrc4	A	T	17: 74,448,083	L46*	probably null	Het
Olfr157	A	G	4: 43,836,010	I160T	probably benign	Het
Olfr836	A	T	9: 19,121,077	T38S	probably damaging	Het
Olfr933	T	C	9: 38,975,855	Y60H	possibly damaging	Het
Orm1	A	G	4: 63,345,993		probably null	Het
Parva	A	T	7: 112,579,720	H311L	probably benign	Het
Proca1	C	A	11: 78,205,266	S154R	probably damaging	Het
R3hdm2	T	C	10: 127,471,902	V344A	probably damaging	Het
Rabep1	A	T	11: 70,908,421	K293N	probably damaging	Het
Ranbp6	A	G	19: 29,811,683	V423A	probably damaging	Het
Sf3b1	A	T	1: 55,003,150	M498K	possibly damaging	Het
Sin3a	T	C	9: 57,110,988	M897T	probably benign	Het
Sp140	T	A	1: 85,610,828	D95E	possibly damaging	Het
Srbd1	A	C	17: 86,001,536	I738S	possibly damaging	Het
Srsf11	C	T	3: 158,023,344		probably benign	Het
Svep1	A	G	4: 58,072,991	V2106A	possibly damaging	Het
Tex47	G	A	5: 7,304,843	R8Q	probably null	Het
Trpc7	A	G	13: 56,804,550	Y548H	probably damaging	Het
Vmn1r170	A	T	7: 23,606,629	H152L	possibly damaging	Het
Zfp184	A	G	13: 21,959,881	I586V	probably damaging	Het
Zfp454	T	C	11: 50,883,802	T15A	probably damaging	Het

Other mutations in Rnf20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Rnf20	APN	4	49655480	nonsense	probably null
IGL01319:Rnf20	APN	4	49649326	missense	probably damaging	0.99
IGL01666:Rnf20	APN	4	49654486	nonsense	probably null
IGL01975:Rnf20	APN	4	49654473	missense	probably benign	0.00
IGL02130:Rnf20	APN	4	49644481	splice site	probably benign
IGL02179:Rnf20	APN	4	49638712	missense	probably benign	0.04
IGL03096:Rnf20	APN	4	49638615	splice site	probably benign
IGL03120:Rnf20	APN	4	49649955	splice site	probably benign
IGL03208:Rnf20	APN	4	49645706	splice site	probably benign
IGL03257:Rnf20	APN	4	49645687	missense	probably benign	0.19
IGL03349:Rnf20	APN	4	49655936	missense	probably damaging	1.00
R0372:Rnf20	UTSW	4	49650176	missense	possibly damaging	0.53
R0486:Rnf20	UTSW	4	49645907	missense	possibly damaging	0.57
R0791:Rnf20	UTSW	4	49638197	missense	possibly damaging	0.92
R0927:Rnf20	UTSW	4	49642176	missense	probably damaging	1.00
R1256:Rnf20	UTSW	4	49638230	missense	probably benign	0.33
R1272:Rnf20	UTSW	4	49651496	missense	probably damaging	0.99
R1460:Rnf20	UTSW	4	49645873	splice site	probably benign
R1522:Rnf20	UTSW	4	49638197	missense	possibly damaging	0.92
R1698:Rnf20	UTSW	4	49651498	nonsense	probably null
R1848:Rnf20	UTSW	4	49644628	missense	probably damaging	1.00
R2214:Rnf20	UTSW	4	49648344	missense	possibly damaging	0.77
R2497:Rnf20	UTSW	4	49652676	splice site	probably null
R2915:Rnf20	UTSW	4	49638769	missense	probably benign	0.13
R4726:Rnf20	UTSW	4	49654579	nonsense	probably null
R4770:Rnf20	UTSW	4	49633412	critical splice donor site	probably null
R4799:Rnf20	UTSW	4	49649962	critical splice acceptor site	probably null
R4960:Rnf20	UTSW	4	49638029	missense	probably damaging	0.99
R5022:Rnf20	UTSW	4	49642016	intron	probably benign
R5146:Rnf20	UTSW	4	49651456	missense	probably benign	0.21
R5423:Rnf20	UTSW	4	49644620	missense	probably damaging	0.99
R6297:Rnf20	UTSW	4	49642132	missense	probably damaging	1.00
R6608:Rnf20	UTSW	4	49650051	missense	probably benign	0.05
R7064:Rnf20	UTSW	4	49644580	nonsense	probably null
R7776:Rnf20	UTSW	4	49644592	nonsense	probably null
R8735:Rnf20	UTSW	4	49655964	missense	possibly damaging	0.95
R8995:Rnf20	UTSW	4	49648437	missense	possibly damaging	0.94
Z1177:Rnf20	UTSW	4	49645655	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TAATAGGCACAACCGCTGGC -3'
(R):5'- TGGCAGACAAGGATTTCAACG -3'

Sequencing Primer
(F):5'- ACCGCTGGCTATAGATAGGTGC -3'
(R):5'- GCAGACAAGGATTTCAACGTAATAAC -3'

Posted On

2016-08-04