Incidental Mutation 'R5379:Rnf20'
ID 425735
Institutional Source Beutler Lab
Gene Symbol Rnf20
Ensembl Gene ENSMUSG00000028309
Gene Name ring finger protein 20
Synonyms 4833430L21Rik
MMRRC Submission 042954-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5379 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 49632006-49656887 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 49652639 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 711 (Y711N)
Ref Sequence ENSEMBL: ENSMUSP00000128546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029989] [ENSMUST00000156314] [ENSMUST00000167496]
AlphaFold Q5DTM8
Predicted Effect possibly damaging
Transcript: ENSMUST00000029989
AA Change: Y711N

PolyPhen 2 Score 0.465 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029989
Gene: ENSMUSG00000028309
AA Change: Y711N

DomainStartEndE-ValueType
coiled coil region 45 85 N/A INTRINSIC
coiled coil region 172 200 N/A INTRINSIC
coiled coil region 317 378 N/A INTRINSIC
coiled coil region 429 514 N/A INTRINSIC
coiled coil region 550 733 N/A INTRINSIC
coiled coil region 769 805 N/A INTRINSIC
coiled coil region 828 867 N/A INTRINSIC
RING 920 958 2e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149862
Predicted Effect probably benign
Transcript: ENSMUST00000156314
SMART Domains Protein: ENSMUSP00000118293
Gene: ENSMUSG00000028309

DomainStartEndE-ValueType
coiled coil region 45 85 N/A INTRINSIC
low complexity region 164 172 N/A INTRINSIC
SCOP:d1gw5a_ 174 294 3e-3 SMART
coiled coil region 317 378 N/A INTRINSIC
coiled coil region 429 514 N/A INTRINSIC
coiled coil region 550 606 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167496
AA Change: Y711N

PolyPhen 2 Score 0.465 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128546
Gene: ENSMUSG00000028309
AA Change: Y711N

DomainStartEndE-ValueType
coiled coil region 45 85 N/A INTRINSIC
coiled coil region 172 200 N/A INTRINSIC
coiled coil region 317 378 N/A INTRINSIC
coiled coil region 429 514 N/A INTRINSIC
coiled coil region 550 733 N/A INTRINSIC
coiled coil region 769 805 N/A INTRINSIC
coiled coil region 828 867 N/A INTRINSIC
RING 920 958 2e-4 SMART
Meta Mutation Damage Score 0.0661 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with BRE1 of S. cerevisiae. The protein encoded by this human gene is an E3 ubiquitin ligase that regulates chromosome structure by monoubiquitinating histone H2B. This protein acts as a putative tumor suppressor and positively regulates the p53 tumor suppressor as well as numerous histone H2A and H2B genes. In contrast, this protein also suppresses the expression of several protooncogenes and growth-related genes, including many genes that are induced by epidermal growth factor. This gene selectively suppresses the expression of some genes by interfering with chromatin recruitment of transcription elongation factor SII (TFIIS). [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,146,532 L640Q probably damaging Het
Afap1l1 T C 18: 61,758,650 E32G probably damaging Het
Atp1a1 T A 3: 101,582,095 M734L probably benign Het
B4galt6 T C 18: 20,689,239 D294G probably damaging Het
Baz1a T G 12: 54,894,348 D1539A probably damaging Het
Bmper T A 9: 23,297,224 S141T probably benign Het
Camkv T C 9: 107,945,346 V20A probably damaging Het
Chst8 A G 7: 34,675,854 Y187H probably damaging Het
Coro1c A G 5: 113,845,382 Y362H probably damaging Het
Csmd3 C A 15: 47,636,450 G3008* probably null Het
Dnah17 T C 11: 118,117,203 probably benign Het
Dnajb1 C T 8: 83,608,506 R59C possibly damaging Het
Dpf1 A G 7: 29,304,108 K10E probably benign Het
Eif5 T C 12: 111,543,555 L311P probably damaging Het
Eqtn A G 4: 94,907,588 F251S probably damaging Het
Fam208b T C 13: 3,588,496 R412G probably benign Het
Fancg A G 4: 43,002,998 S620P probably benign Het
Farp1 T C 14: 121,256,757 V550A possibly damaging Het
Fat2 T C 11: 55,303,941 T1091A probably damaging Het
Fbxo33 A G 12: 59,219,460 probably benign Het
Fndc5 A T 4: 129,142,094 I175F probably damaging Het
Gm13023 A G 4: 143,794,923 I370V probably benign Het
Gtf2ird2 G C 5: 134,217,468 R856P probably benign Het
Hc A T 2: 34,991,065 F1481I probably damaging Het
Helz2 T A 2: 181,235,069 T1211S probably benign Het
Hmcn2 G A 2: 31,409,011 V2790M probably damaging Het
Ighv1-82 T C 12: 115,952,677 Y71C probably damaging Het
Itgam A G 7: 128,112,388 D725G probably damaging Het
Kif9 T C 9: 110,521,303 V754A probably benign Het
Larp4b C A 13: 9,136,909 T91K probably benign Het
Mki67 T C 7: 135,697,461 E1948G possibly damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mrgprb13 A T 7: 48,311,748 noncoding transcript Het
Nlrc4 A T 17: 74,448,083 L46* probably null Het
Olfr157 A G 4: 43,836,010 I160T probably benign Het
Olfr836 A T 9: 19,121,077 T38S probably damaging Het
Olfr933 T C 9: 38,975,855 Y60H possibly damaging Het
Orm1 A G 4: 63,345,993 probably null Het
Parva A T 7: 112,579,720 H311L probably benign Het
Proca1 C A 11: 78,205,266 S154R probably damaging Het
R3hdm2 T C 10: 127,471,902 V344A probably damaging Het
Rabep1 A T 11: 70,908,421 K293N probably damaging Het
Ranbp6 A G 19: 29,811,683 V423A probably damaging Het
Sf3b1 A T 1: 55,003,150 M498K possibly damaging Het
Sin3a T C 9: 57,110,988 M897T probably benign Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Srbd1 A C 17: 86,001,536 I738S possibly damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Svep1 A G 4: 58,072,991 V2106A possibly damaging Het
Tex47 G A 5: 7,304,843 R8Q probably null Het
Trpc7 A G 13: 56,804,550 Y548H probably damaging Het
Vmn1r170 A T 7: 23,606,629 H152L possibly damaging Het
Zfp184 A G 13: 21,959,881 I586V probably damaging Het
Zfp454 T C 11: 50,883,802 T15A probably damaging Het
Other mutations in Rnf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Rnf20 APN 4 49655480 nonsense probably null
IGL01319:Rnf20 APN 4 49649326 missense probably damaging 0.99
IGL01666:Rnf20 APN 4 49654486 nonsense probably null
IGL01975:Rnf20 APN 4 49654473 missense probably benign 0.00
IGL02130:Rnf20 APN 4 49644481 splice site probably benign
IGL02179:Rnf20 APN 4 49638712 missense probably benign 0.04
IGL03096:Rnf20 APN 4 49638615 splice site probably benign
IGL03120:Rnf20 APN 4 49649955 splice site probably benign
IGL03208:Rnf20 APN 4 49645706 splice site probably benign
IGL03257:Rnf20 APN 4 49645687 missense probably benign 0.19
IGL03349:Rnf20 APN 4 49655936 missense probably damaging 1.00
R0372:Rnf20 UTSW 4 49650176 missense possibly damaging 0.53
R0486:Rnf20 UTSW 4 49645907 missense possibly damaging 0.57
R0791:Rnf20 UTSW 4 49638197 missense possibly damaging 0.92
R0927:Rnf20 UTSW 4 49642176 missense probably damaging 1.00
R1256:Rnf20 UTSW 4 49638230 missense probably benign 0.33
R1272:Rnf20 UTSW 4 49651496 missense probably damaging 0.99
R1460:Rnf20 UTSW 4 49645873 splice site probably benign
R1522:Rnf20 UTSW 4 49638197 missense possibly damaging 0.92
R1698:Rnf20 UTSW 4 49651498 nonsense probably null
R1848:Rnf20 UTSW 4 49644628 missense probably damaging 1.00
R2214:Rnf20 UTSW 4 49648344 missense possibly damaging 0.77
R2497:Rnf20 UTSW 4 49652676 splice site probably null
R2915:Rnf20 UTSW 4 49638769 missense probably benign 0.13
R4726:Rnf20 UTSW 4 49654579 nonsense probably null
R4770:Rnf20 UTSW 4 49633412 critical splice donor site probably null
R4799:Rnf20 UTSW 4 49649962 critical splice acceptor site probably null
R4960:Rnf20 UTSW 4 49638029 missense probably damaging 0.99
R5022:Rnf20 UTSW 4 49642016 intron probably benign
R5146:Rnf20 UTSW 4 49651456 missense probably benign 0.21
R5423:Rnf20 UTSW 4 49644620 missense probably damaging 0.99
R6297:Rnf20 UTSW 4 49642132 missense probably damaging 1.00
R6608:Rnf20 UTSW 4 49650051 missense probably benign 0.05
R7064:Rnf20 UTSW 4 49644580 nonsense probably null
R7776:Rnf20 UTSW 4 49644592 nonsense probably null
R8735:Rnf20 UTSW 4 49655964 missense possibly damaging 0.95
R8995:Rnf20 UTSW 4 49648437 missense possibly damaging 0.94
Z1177:Rnf20 UTSW 4 49645655 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAATAGGCACAACCGCTGGC -3'
(R):5'- TGGCAGACAAGGATTTCAACG -3'

Sequencing Primer
(F):5'- ACCGCTGGCTATAGATAGGTGC -3'
(R):5'- GCAGACAAGGATTTCAACGTAATAAC -3'
Posted On 2016-08-04