Incidental Mutation 'R5379:Fndc5'
ID425739
Institutional Source Beutler Lab
Gene Symbol Fndc5
Ensembl Gene ENSMUSG00000001334
Gene Namefibronectin type III domain containing 5
Synonyms1500001L03Rik, PeP, Pxp
MMRRC Submission 042954-MU
Accession Numbers

Genbank: NM_027402; MGI: 1917614  

Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R5379 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location129136999-129144593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129142094 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 175 (I175F)
Ref Sequence ENSEMBL: ENSMUSP00000099660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102600]
Predicted Effect probably damaging
Transcript: ENSMUST00000102600
AA Change: I175F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099660
Gene: ENSMUSG00000001334
AA Change: I175F

DomainStartEndE-ValueType
FN3 31 111 7.34e-9 SMART
Pfam:DUF4808 146 204 4.7e-10 PFAM
Meta Mutation Damage Score 0.1247 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: This gene encodes a type I transmembrane protein containing fibronectin type III repeat. The encoded transmembrane protein undergoes proteolytic processing to generate a soluble hormone named irisin that is secreted into the bloodstream. The expression of this gene followed by the secretion of irisin from skeletal muscle is induced by exercise. The ectopic expression of the encoded protein in mice causes an elevation of irisin in blood and improves metabolic health. [provided by RefSeq, Jul 2016]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,146,532 L640Q probably damaging Het
Afap1l1 T C 18: 61,758,650 E32G probably damaging Het
Atp1a1 T A 3: 101,582,095 M734L probably benign Het
B4galt6 T C 18: 20,689,239 D294G probably damaging Het
Baz1a T G 12: 54,894,348 D1539A probably damaging Het
Bmper T A 9: 23,297,224 S141T probably benign Het
Camkv T C 9: 107,945,346 V20A probably damaging Het
Chst8 A G 7: 34,675,854 Y187H probably damaging Het
Coro1c A G 5: 113,845,382 Y362H probably damaging Het
Csmd3 C A 15: 47,636,450 G3008* probably null Het
Dnah17 T C 11: 118,117,203 probably benign Het
Dnajb1 C T 8: 83,608,506 R59C possibly damaging Het
Dpf1 A G 7: 29,304,108 K10E probably benign Het
Eif5 T C 12: 111,543,555 L311P probably damaging Het
Eqtn A G 4: 94,907,588 F251S probably damaging Het
Fam208b T C 13: 3,588,496 R412G probably benign Het
Fancg A G 4: 43,002,998 S620P probably benign Het
Farp1 T C 14: 121,256,757 V550A possibly damaging Het
Fat2 T C 11: 55,303,941 T1091A probably damaging Het
Fbxo33 A G 12: 59,219,460 probably benign Het
Gm13023 A G 4: 143,794,923 I370V probably benign Het
Gtf2ird2 G C 5: 134,217,468 R856P probably benign Het
Hc A T 2: 34,991,065 F1481I probably damaging Het
Helz2 T A 2: 181,235,069 T1211S probably benign Het
Hmcn2 G A 2: 31,409,011 V2790M probably damaging Het
Ighv1-82 T C 12: 115,952,677 Y71C probably damaging Het
Itgam A G 7: 128,112,388 D725G probably damaging Het
Kif9 T C 9: 110,521,303 V754A probably benign Het
Larp4b C A 13: 9,136,909 T91K probably benign Het
Mki67 T C 7: 135,697,461 E1948G possibly damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mrgprb13 A T 7: 48,311,748 noncoding transcript Het
Nlrc4 A T 17: 74,448,083 L46* probably null Het
Olfr157 A G 4: 43,836,010 I160T probably benign Het
Olfr836 A T 9: 19,121,077 T38S probably damaging Het
Olfr933 T C 9: 38,975,855 Y60H possibly damaging Het
Orm1 A G 4: 63,345,993 probably null Het
Parva A T 7: 112,579,720 H311L probably benign Het
Proca1 C A 11: 78,205,266 S154R probably damaging Het
R3hdm2 T C 10: 127,471,902 V344A probably damaging Het
Rabep1 A T 11: 70,908,421 K293N probably damaging Het
Ranbp6 A G 19: 29,811,683 V423A probably damaging Het
Rnf20 T A 4: 49,652,639 Y711N possibly damaging Het
Sf3b1 A T 1: 55,003,150 M498K possibly damaging Het
Sin3a T C 9: 57,110,988 M897T probably benign Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Srbd1 A C 17: 86,001,536 I738S possibly damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Svep1 A G 4: 58,072,991 V2106A possibly damaging Het
Tex47 G A 5: 7,304,843 R8Q probably null Het
Trpc7 A G 13: 56,804,550 Y548H probably damaging Het
Vmn1r170 A T 7: 23,606,629 H152L possibly damaging Het
Zfp184 A G 13: 21,959,881 I586V probably damaging Het
Zfp454 T C 11: 50,883,802 T15A probably damaging Het
Other mutations in Fndc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02656:Fndc5 APN 4 129139446 missense probably damaging 1.00
IGL03336:Fndc5 APN 4 129139918 missense probably benign 0.00
N/A - 287:Fndc5 UTSW 4 129139349 missense probably damaging 1.00
R0645:Fndc5 UTSW 4 129139837 splice site probably benign
R1202:Fndc5 UTSW 4 129139445 missense probably damaging 0.97
R3962:Fndc5 UTSW 4 129139895 missense probably benign 0.23
R4408:Fndc5 UTSW 4 129142529 splice site probably null
R5539:Fndc5 UTSW 4 129138721 missense probably damaging 1.00
R6242:Fndc5 UTSW 4 129139895 missense probably benign 0.23
R6951:Fndc5 UTSW 4 129138780 missense possibly damaging 0.77
R7027:Fndc5 UTSW 4 129139523 missense probably benign 0.00
R7112:Fndc5 UTSW 4 129142122 missense probably benign 0.09
R8254:Fndc5 UTSW 4 129138721 missense possibly damaging 0.86
RF014:Fndc5 UTSW 4 129142167 missense probably benign 0.00
Z31818:Fndc5 UTSW 4 129139349 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGAAGGCATGATCAGATTC -3'
(R):5'- TTCCCTTGTGCAGTCTAGGG -3'

Sequencing Primer
(F):5'- ATCAGATTCATGCTGTGGGGGAAC -3'
(R):5'- TCTAGGGACTACAGATGTCTAAGGAC -3'
Posted On2016-08-04