Incidental Mutation 'R5379:Gtf2ird2'
ID425743
Institutional Source Beutler Lab
Gene Symbol Gtf2ird2
Ensembl Gene ENSMUSG00000015942
Gene NameGTF2I repeat domain containing 2
Synonyms1700012P16Rik
MMRRC Submission 042954-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R5379 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location134184019-134224355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 134217468 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Proline at position 856 (R856P)
Ref Sequence ENSEMBL: ENSMUSP00000016086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016086] [ENSMUST00000016094] [ENSMUST00000111275] [ENSMUST00000123941] [ENSMUST00000144086] [ENSMUST00000146354] [ENSMUST00000152587]
Predicted Effect probably benign
Transcript: ENSMUST00000016086
AA Change: R856P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000016086
Gene: ENSMUSG00000015942
AA Change: R856P

DomainStartEndE-ValueType
Pfam:GTF2I 104 178 6.1e-31 PFAM
Pfam:GTF2I 328 402 1.6e-25 PFAM
Blast:Tryp_SPc 436 491 4e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000016094
SMART Domains Protein: ENSMUSP00000016094
Gene: ENSMUSG00000015950

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
Pfam:p47_phox_C 332 403 1.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111275
SMART Domains Protein: ENSMUSP00000106906
Gene: ENSMUSG00000015950

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
Pfam:p47_phox_C 332 390 5.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128842
Predicted Effect probably benign
Transcript: ENSMUST00000135588
Predicted Effect probably benign
Transcript: ENSMUST00000144086
SMART Domains Protein: ENSMUSP00000138547
Gene: ENSMUSG00000015950

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
low complexity region 336 344 N/A INTRINSIC
low complexity region 349 367 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146354
SMART Domains Protein: ENSMUSP00000138121
Gene: ENSMUSG00000015950

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
Pfam:p47_phox_C 332 390 5.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182626
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,146,532 L640Q probably damaging Het
Afap1l1 T C 18: 61,758,650 E32G probably damaging Het
Atp1a1 T A 3: 101,582,095 M734L probably benign Het
B4galt6 T C 18: 20,689,239 D294G probably damaging Het
Baz1a T G 12: 54,894,348 D1539A probably damaging Het
Bmper T A 9: 23,297,224 S141T probably benign Het
Camkv T C 9: 107,945,346 V20A probably damaging Het
Chst8 A G 7: 34,675,854 Y187H probably damaging Het
Coro1c A G 5: 113,845,382 Y362H probably damaging Het
Csmd3 C A 15: 47,636,450 G3008* probably null Het
Dnah17 T C 11: 118,117,203 probably benign Het
Dnajb1 C T 8: 83,608,506 R59C possibly damaging Het
Dpf1 A G 7: 29,304,108 K10E probably benign Het
Eif5 T C 12: 111,543,555 L311P probably damaging Het
Eqtn A G 4: 94,907,588 F251S probably damaging Het
Fam208b T C 13: 3,588,496 R412G probably benign Het
Fancg A G 4: 43,002,998 S620P probably benign Het
Farp1 T C 14: 121,256,757 V550A possibly damaging Het
Fat2 T C 11: 55,303,941 T1091A probably damaging Het
Fbxo33 A G 12: 59,219,460 probably benign Het
Fndc5 A T 4: 129,142,094 I175F probably damaging Het
Gm13023 A G 4: 143,794,923 I370V probably benign Het
Hc A T 2: 34,991,065 F1481I probably damaging Het
Helz2 T A 2: 181,235,069 T1211S probably benign Het
Hmcn2 G A 2: 31,409,011 V2790M probably damaging Het
Ighv1-82 T C 12: 115,952,677 Y71C probably damaging Het
Itgam A G 7: 128,112,388 D725G probably damaging Het
Kif9 T C 9: 110,521,303 V754A probably benign Het
Larp4b C A 13: 9,136,909 T91K probably benign Het
Mki67 T C 7: 135,697,461 E1948G possibly damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mrgprb13 A T 7: 48,311,748 noncoding transcript Het
Nlrc4 A T 17: 74,448,083 L46* probably null Het
Olfr157 A G 4: 43,836,010 I160T probably benign Het
Olfr836 A T 9: 19,121,077 T38S probably damaging Het
Olfr933 T C 9: 38,975,855 Y60H possibly damaging Het
Orm1 A G 4: 63,345,993 probably null Het
Parva A T 7: 112,579,720 H311L probably benign Het
Proca1 C A 11: 78,205,266 S154R probably damaging Het
R3hdm2 T C 10: 127,471,902 V344A probably damaging Het
Rabep1 A T 11: 70,908,421 K293N probably damaging Het
Ranbp6 A G 19: 29,811,683 V423A probably damaging Het
Rnf20 T A 4: 49,652,639 Y711N possibly damaging Het
Sf3b1 A T 1: 55,003,150 M498K possibly damaging Het
Sin3a T C 9: 57,110,988 M897T probably benign Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Srbd1 A C 17: 86,001,536 I738S possibly damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Svep1 A G 4: 58,072,991 V2106A possibly damaging Het
Tex47 G A 5: 7,304,843 R8Q probably null Het
Trpc7 A G 13: 56,804,550 Y548H probably damaging Het
Vmn1r170 A T 7: 23,606,629 H152L possibly damaging Het
Zfp184 A G 13: 21,959,881 I586V probably damaging Het
Zfp454 T C 11: 50,883,802 T15A probably damaging Het
Other mutations in Gtf2ird2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Gtf2ird2 APN 5 134196553 missense possibly damaging 0.93
IGL01295:Gtf2ird2 APN 5 134192764 missense probably damaging 1.00
IGL01603:Gtf2ird2 APN 5 134202288 splice site probably benign
IGL01824:Gtf2ird2 APN 5 134197282 splice site probably benign
IGL02469:Gtf2ird2 APN 5 134191249 missense probably damaging 1.00
IGL02525:Gtf2ird2 APN 5 134216477 missense probably benign 0.03
IGL02567:Gtf2ird2 APN 5 134213048 unclassified probably benign
IGL02750:Gtf2ird2 APN 5 134216889 missense probably damaging 0.99
IGL02992:Gtf2ird2 APN 5 134217614 missense possibly damaging 0.79
IGL03000:Gtf2ird2 APN 5 134194906 missense probably benign 0.45
IGL03114:Gtf2ird2 APN 5 134216910 unclassified probably null
IGL03180:Gtf2ird2 APN 5 134191248 missense probably damaging 1.00
R0077:Gtf2ird2 UTSW 5 134214083 missense probably damaging 1.00
R0100:Gtf2ird2 UTSW 5 134217015 missense probably damaging 0.97
R0100:Gtf2ird2 UTSW 5 134217015 missense probably damaging 0.97
R0344:Gtf2ird2 UTSW 5 134191249 missense probably damaging 1.00
R0568:Gtf2ird2 UTSW 5 134211242 nonsense probably null
R0570:Gtf2ird2 UTSW 5 134208944 critical splice donor site probably null
R0730:Gtf2ird2 UTSW 5 134192758 nonsense probably null
R0826:Gtf2ird2 UTSW 5 134216955 missense probably damaging 1.00
R1707:Gtf2ird2 UTSW 5 134216987 missense probably damaging 1.00
R1710:Gtf2ird2 UTSW 5 134211240 missense probably benign 0.26
R2064:Gtf2ird2 UTSW 5 134216498 nonsense probably null
R2284:Gtf2ird2 UTSW 5 134217183 missense probably benign 0.05
R2375:Gtf2ird2 UTSW 5 134217135 missense probably benign 0.20
R3104:Gtf2ird2 UTSW 5 134208915 missense probably benign 0.42
R4436:Gtf2ird2 UTSW 5 134194969 missense possibly damaging 0.95
R4647:Gtf2ird2 UTSW 5 134216192 missense probably damaging 1.00
R4708:Gtf2ird2 UTSW 5 134216298 missense probably damaging 0.99
R4775:Gtf2ird2 UTSW 5 134214128 missense probably benign 0.01
R4999:Gtf2ird2 UTSW 5 134217464 missense probably damaging 0.97
R5011:Gtf2ird2 UTSW 5 134216982 missense possibly damaging 0.90
R5036:Gtf2ird2 UTSW 5 134217507 missense probably damaging 1.00
R5261:Gtf2ird2 UTSW 5 134216219 missense probably benign 0.00
R5921:Gtf2ird2 UTSW 5 134217584 missense probably damaging 1.00
R6180:Gtf2ird2 UTSW 5 134216547 missense probably damaging 1.00
R6483:Gtf2ird2 UTSW 5 134211225 missense probably benign 0.00
R7355:Gtf2ird2 UTSW 5 134216649 missense probably benign 0.24
R7475:Gtf2ird2 UTSW 5 134201426 missense possibly damaging 0.47
R7566:Gtf2ird2 UTSW 5 134214006 missense probably damaging 1.00
R8021:Gtf2ird2 UTSW 5 134203334 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCACGCTGAAATCGGTTTC -3'
(R):5'- GAGGAATGGCCAGATTTCCTTCC -3'

Sequencing Primer
(F):5'- TTTCCCGGAGTGAAAGCGAC -3'
(R):5'- CCTCCGCAGTAGTGGGATTGAAG -3'
Posted On2016-08-04