Mutagenetix > Incidental Mutations

Incidental Mutation 'R5379:Mki67'

425751

Institutional Source

Beutler Lab

Gene Symbol

Mki67

Ensembl Gene

ENSMUSG00000031004

Gene Name

antigen identified by monoclonal antibody Ki 67

Synonyms

D630048A14Rik, Ki-67, Ki67

MMRRC Submission

042954-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.811) question?

Stock #

R5379 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

135689784-135716361 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 135697461 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1948 (E1948G)

Ref Sequence

ENSEMBL: ENSMUSP00000033310 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033310]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000033310
AA Change: E1948G

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000033310
Gene: ENSMUSG00000031004
AA Change: E1948G

Domain	Start	End	E-Value	Type
FHA	26	76	1.03e-11	SMART
Pfam:PP1_bind	462	519	2.8e-20	PFAM
low complexity region	535	545	N/A	INTRINSIC
low complexity region	869	882	N/A	INTRINSIC
Pfam:K167R	889	982	1.5e-9	PFAM
K167R	993	1102	2.01e-39	SMART
K167R	1107	1217	1.87e-57	SMART
K167R	1228	1337	1.33e-53	SMART
K167R	1348	1451	6.57e-44	SMART
K167R	1462	1570	9.09e-38	SMART
K167R	1580	1686	5.02e-40	SMART
K167R	1697	1807	9.6e-37	SMART
K167R	1818	1926	5.94e-51	SMART
K167R	1937	2047	1.6e-56	SMART
K167R	2058	2164	4.04e-53	SMART
K167R	2175	2285	1.52e-57	SMART
K167R	2296	2407	1.78e-40	SMART
K167R	2418	2527	1.71e-42	SMART
K167R	2538	2640	7.41e-20	SMART
K167R	2642	2750	1.06e-38	SMART
K167R	2761	2872	2.1e-42	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

97% (58/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is associated with and may be necessary for cellular proliferation. Alternatively spliced transcript variants have been described. A related pseudogene exists on chromosome X. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice carrying a reporter allele show expression in actively dividing cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy1	T	A	11: 7,146,532	L640Q	probably damaging	Het
Afap1l1	T	C	18: 61,758,650	E32G	probably damaging	Het
Atp1a1	T	A	3: 101,582,095	M734L	probably benign	Het
B4galt6	T	C	18: 20,689,239	D294G	probably damaging	Het
Baz1a	T	G	12: 54,894,348	D1539A	probably damaging	Het
Bmper	T	A	9: 23,297,224	S141T	probably benign	Het
Camkv	T	C	9: 107,945,346	V20A	probably damaging	Het
Chst8	A	G	7: 34,675,854	Y187H	probably damaging	Het
Coro1c	A	G	5: 113,845,382	Y362H	probably damaging	Het
Csmd3	C	A	15: 47,636,450	G3008*	probably null	Het
Dnah17	T	C	11: 118,117,203		probably benign	Het
Dnajb1	C	T	8: 83,608,506	R59C	possibly damaging	Het
Dpf1	A	G	7: 29,304,108	K10E	probably benign	Het
Eif5	T	C	12: 111,543,555	L311P	probably damaging	Het
Eqtn	A	G	4: 94,907,588	F251S	probably damaging	Het
Fam208b	T	C	13: 3,588,496	R412G	probably benign	Het
Fancg	A	G	4: 43,002,998	S620P	probably benign	Het
Farp1	T	C	14: 121,256,757	V550A	possibly damaging	Het
Fat2	T	C	11: 55,303,941	T1091A	probably damaging	Het
Fbxo33	A	G	12: 59,219,460		probably benign	Het
Fndc5	A	T	4: 129,142,094	I175F	probably damaging	Het
Gm13023	A	G	4: 143,794,923	I370V	probably benign	Het
Gtf2ird2	G	C	5: 134,217,468	R856P	probably benign	Het
Hc	A	T	2: 34,991,065	F1481I	probably damaging	Het
Helz2	T	A	2: 181,235,069	T1211S	probably benign	Het
Hmcn2	G	A	2: 31,409,011	V2790M	probably damaging	Het
Ighv1-82	T	C	12: 115,952,677	Y71C	probably damaging	Het
Itgam	A	G	7: 128,112,388	D725G	probably damaging	Het
Kif9	T	C	9: 110,521,303	V754A	probably benign	Het
Larp4b	C	A	13: 9,136,909	T91K	probably benign	Het
Mllt6	G	A	11: 97,669,500	S210N	possibly damaging	Het
Mrgprb13	A	T	7: 48,311,748		noncoding transcript	Het
Nlrc4	A	T	17: 74,448,083	L46*	probably null	Het
Olfr157	A	G	4: 43,836,010	I160T	probably benign	Het
Olfr836	A	T	9: 19,121,077	T38S	probably damaging	Het
Olfr933	T	C	9: 38,975,855	Y60H	possibly damaging	Het
Orm1	A	G	4: 63,345,993		probably null	Het
Parva	A	T	7: 112,579,720	H311L	probably benign	Het
Proca1	C	A	11: 78,205,266	S154R	probably damaging	Het
R3hdm2	T	C	10: 127,471,902	V344A	probably damaging	Het
Rabep1	A	T	11: 70,908,421	K293N	probably damaging	Het
Ranbp6	A	G	19: 29,811,683	V423A	probably damaging	Het
Rnf20	T	A	4: 49,652,639	Y711N	possibly damaging	Het
Sf3b1	A	T	1: 55,003,150	M498K	possibly damaging	Het
Sin3a	T	C	9: 57,110,988	M897T	probably benign	Het
Sp140	T	A	1: 85,610,828	D95E	possibly damaging	Het
Srbd1	A	C	17: 86,001,536	I738S	possibly damaging	Het
Srsf11	C	T	3: 158,023,344		probably benign	Het
Svep1	A	G	4: 58,072,991	V2106A	possibly damaging	Het
Tex47	G	A	5: 7,304,843	R8Q	probably null	Het
Trpc7	A	G	13: 56,804,550	Y548H	probably damaging	Het
Vmn1r170	A	T	7: 23,606,629	H152L	possibly damaging	Het
Zfp184	A	G	13: 21,959,881	I586V	probably damaging	Het
Zfp454	T	C	11: 50,883,802	T15A	probably damaging	Het

Other mutations in Mki67

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00225:Mki67	APN	7	135690120	missense	probably benign	0.32
IGL00264:Mki67	APN	7	135707820	nonsense	probably null
IGL00328:Mki67	APN	7	135696695	missense	probably benign	0.03
IGL00570:Mki67	APN	7	135708101	missense	possibly damaging	0.88
IGL00584:Mki67	APN	7	135695695	missense	probably damaging	1.00
IGL00756:Mki67	APN	7	135698731	missense	possibly damaging	0.76
IGL01063:Mki67	APN	7	135694922	missense	possibly damaging	0.93
IGL01112:Mki67	APN	7	135714016	missense	probably damaging	1.00
IGL01360:Mki67	APN	7	135705776	missense	probably damaging	1.00
IGL01457:Mki67	APN	7	135699546	missense	probably benign	0.00
IGL01686:Mki67	APN	7	135707813	missense	probably benign	0.00
IGL01731:Mki67	APN	7	135696549	missense	probably benign	0.03
IGL01775:Mki67	APN	7	135698276	missense	possibly damaging	0.71
IGL01806:Mki67	APN	7	135698957	missense	probably damaging	0.98
IGL01860:Mki67	APN	7	135698957	missense	probably damaging	0.98
IGL01938:Mki67	APN	7	135694330	missense	probably benign	0.04
IGL02249:Mki67	APN	7	135700522	missense	possibly damaging	0.47
IGL02260:Mki67	APN	7	135701968	missense	probably benign	0.00
IGL02270:Mki67	APN	7	135698632	missense	probably damaging	1.00
IGL02406:Mki67	APN	7	135698793	missense	probably benign	0.00
IGL02499:Mki67	APN	7	135694327	missense	possibly damaging	0.94
IGL02655:Mki67	APN	7	135714019	missense	probably damaging	0.98
IGL02700:Mki67	APN	7	135708202	missense	probably benign	0.02
IGL03370:Mki67	APN	7	135695490	missense	probably benign	0.00
PIT4468001:Mki67	UTSW	7	135699147	missense	probably benign	0.00
R0001:Mki67	UTSW	7	135699172	missense	probably damaging	1.00
R0001:Mki67	UTSW	7	135701019	missense	probably damaging	0.99
R0043:Mki67	UTSW	7	135700581	missense	probably benign	0.16
R0043:Mki67	UTSW	7	135700581	missense	probably benign	0.16
R0102:Mki67	UTSW	7	135713803	missense	probably benign	0.16
R0130:Mki67	UTSW	7	135696459	missense	probably damaging	1.00
R0149:Mki67	UTSW	7	135698424	missense	probably benign	0.00
R0356:Mki67	UTSW	7	135704406	missense	probably benign	0.34
R0482:Mki67	UTSW	7	135699429	missense	possibly damaging	0.60
R0508:Mki67	UTSW	7	135700346	missense	probably benign
R0532:Mki67	UTSW	7	135698164	nonsense	probably null
R0548:Mki67	UTSW	7	135695256	missense	probably damaging	1.00
R0548:Mki67	UTSW	7	135696908	missense	possibly damaging	0.82
R0557:Mki67	UTSW	7	135699261	missense	possibly damaging	0.48
R0627:Mki67	UTSW	7	135708258	missense	probably benign	0.31
R0631:Mki67	UTSW	7	135704388	missense	probably damaging	0.98
R0848:Mki67	UTSW	7	135701043	missense	probably benign	0.21
R1075:Mki67	UTSW	7	135697311	missense	probably benign	0.03
R1105:Mki67	UTSW	7	135701050	missense	probably benign	0.09
R1272:Mki67	UTSW	7	135700414	nonsense	probably null
R1331:Mki67	UTSW	7	135698276	missense	possibly damaging	0.71
R1486:Mki67	UTSW	7	135699720	missense	probably benign	0.00
R1510:Mki67	UTSW	7	135696171	missense	probably benign	0.26
R1573:Mki67	UTSW	7	135695116	missense	possibly damaging	0.93
R1586:Mki67	UTSW	7	135713972	nonsense	probably null
R1599:Mki67	UTSW	7	135699934	missense	probably benign	0.34
R1623:Mki67	UTSW	7	135708818	splice site	probably null
R1706:Mki67	UTSW	7	135700566	missense	probably benign	0.37
R1718:Mki67	UTSW	7	135695494	missense	probably damaging	1.00
R1785:Mki67	UTSW	7	135704241	critical splice acceptor site	probably null
R1816:Mki67	UTSW	7	135707387	missense	possibly damaging	0.68
R1862:Mki67	UTSW	7	135699361	missense	probably benign	0.09
R1929:Mki67	UTSW	7	135698065	missense	possibly damaging	0.46
R1957:Mki67	UTSW	7	135698399	missense	probably benign	0.01
R1971:Mki67	UTSW	7	135713959	critical splice donor site	probably null
R1998:Mki67	UTSW	7	135705770	missense	probably benign	0.00
R2004:Mki67	UTSW	7	135698509	nonsense	probably null
R2005:Mki67	UTSW	7	135698509	nonsense	probably null
R2006:Mki67	UTSW	7	135698509	nonsense	probably null
R2109:Mki67	UTSW	7	135697863	missense	probably damaging	1.00
R2130:Mki67	UTSW	7	135704241	critical splice acceptor site	probably null
R2131:Mki67	UTSW	7	135704241	critical splice acceptor site	probably null
R2133:Mki67	UTSW	7	135704241	critical splice acceptor site	probably null
R2140:Mki67	UTSW	7	135695592	missense	possibly damaging	0.94
R2141:Mki67	UTSW	7	135695592	missense	possibly damaging	0.94
R2142:Mki67	UTSW	7	135695592	missense	possibly damaging	0.94
R2284:Mki67	UTSW	7	135699945	missense	probably damaging	0.99
R2869:Mki67	UTSW	7	135708149	missense	probably benign	0.19
R2869:Mki67	UTSW	7	135708149	missense	probably benign	0.19
R2871:Mki67	UTSW	7	135708149	missense	probably benign	0.19
R2871:Mki67	UTSW	7	135708149	missense	probably benign	0.19
R2913:Mki67	UTSW	7	135700686	missense	possibly damaging	0.71
R3404:Mki67	UTSW	7	135707475	missense	probably benign	0.01
R3405:Mki67	UTSW	7	135707475	missense	probably benign	0.01
R3406:Mki67	UTSW	7	135707475	missense	probably benign	0.01
R3777:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3778:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3787:Mki67	UTSW	7	135700283	missense	possibly damaging	0.93
R3847:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3848:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3853:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3971:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3972:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R4258:Mki67	UTSW	7	135695288	missense	possibly damaging	0.86
R4343:Mki67	UTSW	7	135695118	missense	probably benign	0.10
R4488:Mki67	UTSW	7	135697671	missense	probably benign	0.01
R4528:Mki67	UTSW	7	135695359	missense	probably damaging	1.00
R4713:Mki67	UTSW	7	135695469	missense	probably benign	0.35
R4867:Mki67	UTSW	7	135699856	missense	probably damaging	0.97
R4874:Mki67	UTSW	7	135708771	missense	probably damaging	0.97
R4897:Mki67	UTSW	7	135696745	missense	probably damaging	1.00
R5045:Mki67	UTSW	7	135707904	missense	possibly damaging	0.84
R5306:Mki67	UTSW	7	135714001	missense	probably damaging	1.00
R5309:Mki67	UTSW	7	135700830	missense	probably damaging	1.00
R5312:Mki67	UTSW	7	135700830	missense	probably damaging	1.00
R5506:Mki67	UTSW	7	135699981	missense	possibly damaging	0.60
R5513:Mki67	UTSW	7	135707750	missense	probably damaging	0.98
R5742:Mki67	UTSW	7	135704373	missense	probably benign	0.20
R5806:Mki67	UTSW	7	135704605	missense	probably damaging	1.00
R6008:Mki67	UTSW	7	135697429	missense	probably damaging	1.00
R6037:Mki67	UTSW	7	135696803	missense	possibly damaging	0.69
R6037:Mki67	UTSW	7	135696803	missense	possibly damaging	0.69
R6221:Mki67	UTSW	7	135697914	missense	probably benign	0.18
R6294:Mki67	UTSW	7	135704590	missense	probably benign	0.09
R6377:Mki67	UTSW	7	135696321	missense	possibly damaging	0.67
R6456:Mki67	UTSW	7	135699475	missense	possibly damaging	0.59
R6608:Mki67	UTSW	7	135698361	missense	probably benign	0.01
R6609:Mki67	UTSW	7	135699829	missense	possibly damaging	0.94
R6648:Mki67	UTSW	7	135697440	missense	probably damaging	1.00
R6901:Mki67	UTSW	7	135708760	splice site	probably null
R6978:Mki67	UTSW	7	135701962	missense	probably benign	0.10
R6985:Mki67	UTSW	7	135713865	missense	probably damaging	1.00
R7076:Mki67	UTSW	7	135705629	missense	probably damaging	0.98
R7217:Mki67	UTSW	7	135704182	missense	probably damaging	1.00
R7239:Mki67	UTSW	7	135700176	missense	possibly damaging	0.91
R7250:Mki67	UTSW	7	135699324	missense	possibly damaging	0.90
R7313:Mki67	UTSW	7	135694671	missense	probably benign	0.29
R7336:Mki67	UTSW	7	135713839	missense	probably benign	0.03
R7422:Mki67	UTSW	7	135698370	missense	probably damaging	1.00
R7451:Mki67	UTSW	7	135699351	missense	probably benign	0.01
R7502:Mki67	UTSW	7	135700783	missense	possibly damaging	0.53
R7513:Mki67	UTSW	7	135693223	missense	probably benign
R7578:Mki67	UTSW	7	135700915	missense	possibly damaging	0.68
R7619:Mki67	UTSW	7	135699377	missense	probably benign	0.01
R7646:Mki67	UTSW	7	135696769	missense	possibly damaging	0.63
R7659:Mki67	UTSW	7	135697426	missense	probably damaging	1.00
R7691:Mki67	UTSW	7	135701992	missense	not run
R7780:Mki67	UTSW	7	135713968	missense	probably benign	0.02
R7796:Mki67	UTSW	7	135698194	missense	probably damaging	1.00
X0020:Mki67	UTSW	7	135714001	missense	probably damaging	0.96
X0065:Mki67	UTSW	7	135713844	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TCCATGAAGGCTGTGCTGTC -3'
(R):5'- ACAGTCCAACATGAGTCTCAGG -3'

Sequencing Primer
(F):5'- CATGAAGGCTGTGCTGTCATTTTC -3'
(R):5'- GTCCAACATGAGTCTCAGGAAAGAC -3'

Posted On

2016-08-04