Incidental Mutation 'R5379:Kif9'
ID 425758
Institutional Source Beutler Lab
Gene Symbol Kif9
Ensembl Gene ENSMUSG00000032489
Gene Name kinesin family member 9
Synonyms
MMRRC Submission 042954-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock # R5379 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 110476958-110525179 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 110521303 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 754 (V754A)
Ref Sequence ENSEMBL: ENSMUSP00000142734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061155] [ENSMUST00000084952] [ENSMUST00000197248] [ENSMUST00000198043]
AlphaFold Q9WV04
Predicted Effect probably benign
Transcript: ENSMUST00000061155
AA Change: V754A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000057896
Gene: ENSMUSG00000032489
AA Change: V754A

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 7e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084952
AA Change: V754A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082016
Gene: ENSMUSG00000032489
AA Change: V754A

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 7e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197248
AA Change: V754A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142734
Gene: ENSMUSG00000032489
AA Change: V754A

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 6e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198043
SMART Domains Protein: ENSMUSP00000142689
Gene: ENSMUSG00000032489

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 476 5e-14 BLAST
low complexity region 489 501 N/A INTRINSIC
Meta Mutation Damage Score 0.0774 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,146,532 L640Q probably damaging Het
Afap1l1 T C 18: 61,758,650 E32G probably damaging Het
Atp1a1 T A 3: 101,582,095 M734L probably benign Het
B4galt6 T C 18: 20,689,239 D294G probably damaging Het
Baz1a T G 12: 54,894,348 D1539A probably damaging Het
Bmper T A 9: 23,297,224 S141T probably benign Het
Camkv T C 9: 107,945,346 V20A probably damaging Het
Chst8 A G 7: 34,675,854 Y187H probably damaging Het
Coro1c A G 5: 113,845,382 Y362H probably damaging Het
Csmd3 C A 15: 47,636,450 G3008* probably null Het
Dnah17 T C 11: 118,117,203 probably benign Het
Dnajb1 C T 8: 83,608,506 R59C possibly damaging Het
Dpf1 A G 7: 29,304,108 K10E probably benign Het
Eif5 T C 12: 111,543,555 L311P probably damaging Het
Eqtn A G 4: 94,907,588 F251S probably damaging Het
Fam208b T C 13: 3,588,496 R412G probably benign Het
Fancg A G 4: 43,002,998 S620P probably benign Het
Farp1 T C 14: 121,256,757 V550A possibly damaging Het
Fat2 T C 11: 55,303,941 T1091A probably damaging Het
Fbxo33 A G 12: 59,219,460 probably benign Het
Fndc5 A T 4: 129,142,094 I175F probably damaging Het
Gm13023 A G 4: 143,794,923 I370V probably benign Het
Gtf2ird2 G C 5: 134,217,468 R856P probably benign Het
Hc A T 2: 34,991,065 F1481I probably damaging Het
Helz2 T A 2: 181,235,069 T1211S probably benign Het
Hmcn2 G A 2: 31,409,011 V2790M probably damaging Het
Ighv1-82 T C 12: 115,952,677 Y71C probably damaging Het
Itgam A G 7: 128,112,388 D725G probably damaging Het
Larp4b C A 13: 9,136,909 T91K probably benign Het
Mki67 T C 7: 135,697,461 E1948G possibly damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mrgprb13 A T 7: 48,311,748 noncoding transcript Het
Nlrc4 A T 17: 74,448,083 L46* probably null Het
Olfr157 A G 4: 43,836,010 I160T probably benign Het
Olfr836 A T 9: 19,121,077 T38S probably damaging Het
Olfr933 T C 9: 38,975,855 Y60H possibly damaging Het
Orm1 A G 4: 63,345,993 probably null Het
Parva A T 7: 112,579,720 H311L probably benign Het
Proca1 C A 11: 78,205,266 S154R probably damaging Het
R3hdm2 T C 10: 127,471,902 V344A probably damaging Het
Rabep1 A T 11: 70,908,421 K293N probably damaging Het
Ranbp6 A G 19: 29,811,683 V423A probably damaging Het
Rnf20 T A 4: 49,652,639 Y711N possibly damaging Het
Sf3b1 A T 1: 55,003,150 M498K possibly damaging Het
Sin3a T C 9: 57,110,988 M897T probably benign Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Srbd1 A C 17: 86,001,536 I738S possibly damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Svep1 A G 4: 58,072,991 V2106A possibly damaging Het
Tex47 G A 5: 7,304,843 R8Q probably null Het
Trpc7 A G 13: 56,804,550 Y548H probably damaging Het
Vmn1r170 A T 7: 23,606,629 H152L possibly damaging Het
Zfp184 A G 13: 21,959,881 I586V probably damaging Het
Zfp454 T C 11: 50,883,802 T15A probably damaging Het
Other mutations in Kif9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:Kif9 APN 9 110485070 missense probably benign 0.03
IGL02273:Kif9 APN 9 110510470 missense probably damaging 0.99
IGL02818:Kif9 APN 9 110485149 missense probably damaging 1.00
R0034:Kif9 UTSW 9 110519611 missense probably benign 0.23
R0034:Kif9 UTSW 9 110519611 missense probably benign 0.23
R0047:Kif9 UTSW 9 110485038 missense probably benign 0.05
R0047:Kif9 UTSW 9 110485038 missense probably benign 0.05
R0137:Kif9 UTSW 9 110485038 missense probably damaging 1.00
R0594:Kif9 UTSW 9 110511340 missense probably benign 0.22
R1503:Kif9 UTSW 9 110510438 missense possibly damaging 0.89
R1657:Kif9 UTSW 9 110489966 missense possibly damaging 0.82
R1826:Kif9 UTSW 9 110517633 missense probably benign 0.34
R1856:Kif9 UTSW 9 110517719 missense probably null 1.00
R2076:Kif9 UTSW 9 110485032 splice site probably null
R3407:Kif9 UTSW 9 110519140 missense probably damaging 1.00
R4247:Kif9 UTSW 9 110495959 critical splice donor site probably null
R4487:Kif9 UTSW 9 110494484 missense probably null 1.00
R4515:Kif9 UTSW 9 110489867 missense probably benign 0.38
R4880:Kif9 UTSW 9 110501635 missense probably damaging 0.98
R5024:Kif9 UTSW 9 110483093 missense possibly damaging 0.81
R5093:Kif9 UTSW 9 110489897 missense probably damaging 1.00
R5181:Kif9 UTSW 9 110521268 missense probably damaging 1.00
R5362:Kif9 UTSW 9 110489944 missense probably damaging 0.99
R5628:Kif9 UTSW 9 110514553 nonsense probably null
R5653:Kif9 UTSW 9 110524931 missense probably damaging 1.00
R5698:Kif9 UTSW 9 110510464 missense probably benign
R5758:Kif9 UTSW 9 110489879 missense probably damaging 1.00
R5986:Kif9 UTSW 9 110490026 missense probably benign 0.05
R6103:Kif9 UTSW 9 110489849 missense possibly damaging 0.82
R6247:Kif9 UTSW 9 110488544 missense possibly damaging 0.78
R6255:Kif9 UTSW 9 110517834 splice site probably null
R6991:Kif9 UTSW 9 110494622 missense probably damaging 1.00
R7113:Kif9 UTSW 9 110506664 missense probably damaging 1.00
R7459:Kif9 UTSW 9 110519041 missense probably damaging 1.00
R7593:Kif9 UTSW 9 110521353 missense possibly damaging 0.54
R7892:Kif9 UTSW 9 110514614 missense not run
R8050:Kif9 UTSW 9 110519140 missense probably damaging 1.00
R8370:Kif9 UTSW 9 110488613 missense probably damaging 1.00
R8549:Kif9 UTSW 9 110514419 splice site probably null
R8751:Kif9 UTSW 9 110501656 missense probably benign 0.03
R8830:Kif9 UTSW 9 110524930 missense probably damaging 1.00
R9489:Kif9 UTSW 9 110517642 missense probably benign 0.01
R9519:Kif9 UTSW 9 110521276 missense probably damaging 0.98
R9605:Kif9 UTSW 9 110517642 missense probably benign 0.01
R9776:Kif9 UTSW 9 110521330 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGGAAGGACACTAGCAGAC -3'
(R):5'- CAATCTTCCTGGGCTGGTAC -3'

Sequencing Primer
(F):5'- CAGACATGGATGTTACAGATGCTCTG -3'
(R):5'- TGGGCTGGTACCATCACACAC -3'
Posted On 2016-08-04