Incidental Mutation 'R5379:Kif9'
ID 425758
Institutional Source Beutler Lab
Gene Symbol Kif9
Ensembl Gene ENSMUSG00000032489
Gene Name kinesin family member 9
Synonyms
MMRRC Submission 042954-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R5379 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 110306062-110354242 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 110350371 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 754 (V754A)
Ref Sequence ENSEMBL: ENSMUSP00000142734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061155] [ENSMUST00000084952] [ENSMUST00000197248] [ENSMUST00000198043]
AlphaFold Q9WV04
Predicted Effect probably benign
Transcript: ENSMUST00000061155
AA Change: V754A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000057896
Gene: ENSMUSG00000032489
AA Change: V754A

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 7e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084952
AA Change: V754A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082016
Gene: ENSMUSG00000032489
AA Change: V754A

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 7e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197248
AA Change: V754A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142734
Gene: ENSMUSG00000032489
AA Change: V754A

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 6e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198043
SMART Domains Protein: ENSMUSP00000142689
Gene: ENSMUSG00000032489

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 476 5e-14 BLAST
low complexity region 489 501 N/A INTRINSIC
Meta Mutation Damage Score 0.0774 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,096,532 (GRCm39) L640Q probably damaging Het
Afap1l1 T C 18: 61,891,721 (GRCm39) E32G probably damaging Het
Atp1a1 T A 3: 101,489,411 (GRCm39) M734L probably benign Het
B4galt6 T C 18: 20,822,296 (GRCm39) D294G probably damaging Het
Baz1a T G 12: 54,941,133 (GRCm39) D1539A probably damaging Het
Bmper T A 9: 23,208,520 (GRCm39) S141T probably benign Het
Camkv T C 9: 107,822,545 (GRCm39) V20A probably damaging Het
Chst8 A G 7: 34,375,279 (GRCm39) Y187H probably damaging Het
Coro1c A G 5: 113,983,443 (GRCm39) Y362H probably damaging Het
Csmd3 C A 15: 47,499,846 (GRCm39) G3008* probably null Het
Dnah17 T C 11: 118,008,029 (GRCm39) probably benign Het
Dnajb1 C T 8: 84,335,135 (GRCm39) R59C possibly damaging Het
Dpf1 A G 7: 29,003,533 (GRCm39) K10E probably benign Het
Eif5 T C 12: 111,509,989 (GRCm39) L311P probably damaging Het
Eqtn A G 4: 94,795,825 (GRCm39) F251S probably damaging Het
Fancg A G 4: 43,002,998 (GRCm39) S620P probably benign Het
Farp1 T C 14: 121,494,169 (GRCm39) V550A possibly damaging Het
Fat2 T C 11: 55,194,767 (GRCm39) T1091A probably damaging Het
Fbxo33 A G 12: 59,266,246 (GRCm39) probably benign Het
Fndc5 A T 4: 129,035,887 (GRCm39) I175F probably damaging Het
Gtf2ird2 G C 5: 134,246,310 (GRCm39) R856P probably benign Het
Hc A T 2: 34,881,077 (GRCm39) F1481I probably damaging Het
Helz2 T A 2: 180,876,862 (GRCm39) T1211S probably benign Het
Hmcn2 G A 2: 31,299,023 (GRCm39) V2790M probably damaging Het
Ighv1-82 T C 12: 115,916,297 (GRCm39) Y71C probably damaging Het
Itgam A G 7: 127,711,560 (GRCm39) D725G probably damaging Het
Larp4b C A 13: 9,186,945 (GRCm39) T91K probably benign Het
Mki67 T C 7: 135,299,190 (GRCm39) E1948G possibly damaging Het
Mllt6 G A 11: 97,560,326 (GRCm39) S210N possibly damaging Het
Mrgprb13 A T 7: 47,961,496 (GRCm39) noncoding transcript Het
Nlrc4 A T 17: 74,755,078 (GRCm39) L46* probably null Het
Or13c7c A G 4: 43,836,010 (GRCm39) I160T probably benign Het
Or7g21 A T 9: 19,032,373 (GRCm39) T38S probably damaging Het
Or8d1b T C 9: 38,887,151 (GRCm39) Y60H possibly damaging Het
Orm1 A G 4: 63,264,230 (GRCm39) probably null Het
Parva A T 7: 112,178,927 (GRCm39) H311L probably benign Het
Pramel25 A G 4: 143,521,493 (GRCm39) I370V probably benign Het
Proca1 C A 11: 78,096,092 (GRCm39) S154R probably damaging Het
R3hdm2 T C 10: 127,307,771 (GRCm39) V344A probably damaging Het
Rabep1 A T 11: 70,799,247 (GRCm39) K293N probably damaging Het
Ranbp6 A G 19: 29,789,083 (GRCm39) V423A probably damaging Het
Rnf20 T A 4: 49,652,639 (GRCm39) Y711N possibly damaging Het
Sf3b1 A T 1: 55,042,309 (GRCm39) M498K possibly damaging Het
Sin3a T C 9: 57,018,272 (GRCm39) M897T probably benign Het
Sp140 T A 1: 85,538,549 (GRCm39) D95E possibly damaging Het
Srbd1 A C 17: 86,308,964 (GRCm39) I738S possibly damaging Het
Srsf11 C T 3: 157,728,981 (GRCm39) probably benign Het
Svep1 A G 4: 58,072,991 (GRCm39) V2106A possibly damaging Het
Tasor2 T C 13: 3,638,496 (GRCm39) R412G probably benign Het
Tex47 G A 5: 7,354,843 (GRCm39) R8Q probably null Het
Trpc7 A G 13: 56,952,363 (GRCm39) Y548H probably damaging Het
Vmn1r170 A T 7: 23,306,054 (GRCm39) H152L possibly damaging Het
Zfp184 A G 13: 22,144,051 (GRCm39) I586V probably damaging Het
Zfp454 T C 11: 50,774,629 (GRCm39) T15A probably damaging Het
Other mutations in Kif9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:Kif9 APN 9 110,314,138 (GRCm39) missense probably benign 0.03
IGL02273:Kif9 APN 9 110,339,538 (GRCm39) missense probably damaging 0.99
IGL02818:Kif9 APN 9 110,314,217 (GRCm39) missense probably damaging 1.00
R0034:Kif9 UTSW 9 110,348,679 (GRCm39) missense probably benign 0.23
R0034:Kif9 UTSW 9 110,348,679 (GRCm39) missense probably benign 0.23
R0047:Kif9 UTSW 9 110,314,106 (GRCm39) missense probably benign 0.05
R0047:Kif9 UTSW 9 110,314,106 (GRCm39) missense probably benign 0.05
R0137:Kif9 UTSW 9 110,314,106 (GRCm39) missense probably damaging 1.00
R0594:Kif9 UTSW 9 110,340,408 (GRCm39) missense probably benign 0.22
R1503:Kif9 UTSW 9 110,339,506 (GRCm39) missense possibly damaging 0.89
R1657:Kif9 UTSW 9 110,319,034 (GRCm39) missense possibly damaging 0.82
R1826:Kif9 UTSW 9 110,346,701 (GRCm39) missense probably benign 0.34
R1856:Kif9 UTSW 9 110,346,787 (GRCm39) missense probably null 1.00
R2076:Kif9 UTSW 9 110,314,100 (GRCm39) splice site probably null
R3407:Kif9 UTSW 9 110,348,208 (GRCm39) missense probably damaging 1.00
R4247:Kif9 UTSW 9 110,325,027 (GRCm39) critical splice donor site probably null
R4487:Kif9 UTSW 9 110,323,552 (GRCm39) missense probably null 1.00
R4515:Kif9 UTSW 9 110,318,935 (GRCm39) missense probably benign 0.38
R4880:Kif9 UTSW 9 110,330,703 (GRCm39) missense probably damaging 0.98
R5024:Kif9 UTSW 9 110,312,161 (GRCm39) missense possibly damaging 0.81
R5093:Kif9 UTSW 9 110,318,965 (GRCm39) missense probably damaging 1.00
R5181:Kif9 UTSW 9 110,350,336 (GRCm39) missense probably damaging 1.00
R5362:Kif9 UTSW 9 110,319,012 (GRCm39) missense probably damaging 0.99
R5628:Kif9 UTSW 9 110,343,621 (GRCm39) nonsense probably null
R5653:Kif9 UTSW 9 110,353,999 (GRCm39) missense probably damaging 1.00
R5698:Kif9 UTSW 9 110,339,532 (GRCm39) missense probably benign
R5758:Kif9 UTSW 9 110,318,947 (GRCm39) missense probably damaging 1.00
R5986:Kif9 UTSW 9 110,319,094 (GRCm39) missense probably benign 0.05
R6103:Kif9 UTSW 9 110,318,917 (GRCm39) missense possibly damaging 0.82
R6247:Kif9 UTSW 9 110,317,612 (GRCm39) missense possibly damaging 0.78
R6255:Kif9 UTSW 9 110,346,902 (GRCm39) splice site probably null
R6991:Kif9 UTSW 9 110,323,690 (GRCm39) missense probably damaging 1.00
R7113:Kif9 UTSW 9 110,335,732 (GRCm39) missense probably damaging 1.00
R7459:Kif9 UTSW 9 110,348,109 (GRCm39) missense probably damaging 1.00
R7593:Kif9 UTSW 9 110,350,421 (GRCm39) missense possibly damaging 0.54
R7892:Kif9 UTSW 9 110,343,682 (GRCm39) missense not run
R8050:Kif9 UTSW 9 110,348,208 (GRCm39) missense probably damaging 1.00
R8370:Kif9 UTSW 9 110,317,681 (GRCm39) missense probably damaging 1.00
R8549:Kif9 UTSW 9 110,343,487 (GRCm39) splice site probably null
R8751:Kif9 UTSW 9 110,330,724 (GRCm39) missense probably benign 0.03
R8830:Kif9 UTSW 9 110,353,998 (GRCm39) missense probably damaging 1.00
R9489:Kif9 UTSW 9 110,346,710 (GRCm39) missense probably benign 0.01
R9519:Kif9 UTSW 9 110,350,344 (GRCm39) missense probably damaging 0.98
R9605:Kif9 UTSW 9 110,346,710 (GRCm39) missense probably benign 0.01
R9776:Kif9 UTSW 9 110,350,398 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGGAAGGACACTAGCAGAC -3'
(R):5'- CAATCTTCCTGGGCTGGTAC -3'

Sequencing Primer
(F):5'- CAGACATGGATGTTACAGATGCTCTG -3'
(R):5'- TGGGCTGGTACCATCACACAC -3'
Posted On 2016-08-04