Incidental Mutation 'R5380:Tomm40'
ID425801
Institutional Source Beutler Lab
Gene Symbol Tomm40
Ensembl Gene ENSMUSG00000002984
Gene Nametranslocase of outer mitochondrial membrane 40
SynonymsTom40
MMRRC Submission 042955-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5380 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location19701313-19715438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19701750 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 352 (F352L)
Ref Sequence ENSEMBL: ENSMUSP00000104090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003066] [ENSMUST00000032555] [ENSMUST00000093552] [ENSMUST00000172705] [ENSMUST00000172808] [ENSMUST00000172983] [ENSMUST00000173739] [ENSMUST00000174064] [ENSMUST00000174144] [ENSMUST00000174191] [ENSMUST00000174355] [ENSMUST00000174710]
Predicted Effect probably benign
Transcript: ENSMUST00000003066
SMART Domains Protein: ENSMUSP00000003066
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 291 3.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000032555
AA Change: F352L

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000032555
Gene: ENSMUSG00000002984
AA Change: F352L

DomainStartEndE-ValueType
low complexity region 8 69 N/A INTRINSIC
Pfam:Porin_3 79 355 7.7e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093552
AA Change: F352L

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104090
Gene: ENSMUSG00000002984
AA Change: F352L

DomainStartEndE-ValueType
low complexity region 8 69 N/A INTRINSIC
Pfam:Porin_3 79 355 1.5e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167646
SMART Domains Protein: ENSMUSP00000132032
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 201 1.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172705
SMART Domains Protein: ENSMUSP00000133975
Gene: ENSMUSG00000002984

DomainStartEndE-ValueType
Pfam:Porin_3 1 61 3.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172808
SMART Domains Protein: ENSMUSP00000134558
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Apolipoprotein 61 146 8.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172983
SMART Domains Protein: ENSMUSP00000133359
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 232 1.3e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173739
SMART Domains Protein: ENSMUSP00000133371
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 291 3.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174064
SMART Domains Protein: ENSMUSP00000133302
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 73 284 2e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174144
SMART Domains Protein: ENSMUSP00000134622
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 232 1.3e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174191
SMART Domains Protein: ENSMUSP00000133447
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
PDB:1YA9|A 20 70 8e-31 PDB
SCOP:d1nfn__ 34 70 5e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174355
SMART Domains Protein: ENSMUSP00000134160
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 291 3.8e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174476
Predicted Effect probably benign
Transcript: ENSMUST00000174710
SMART Domains Protein: ENSMUSP00000134429
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
PDB:1YA9|A 20 70 8e-31 PDB
SCOP:d1nfn__ 34 70 5e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208286
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is localized in the outer membrane of the mitochondria. It is the channel-forming subunit of the translocase of the mitochondrial outer membrane (TOM) complex that is essential for import of protein precursors into mitochondria. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012P22Rik A T 4: 144,423,802 W70R probably damaging Het
Aco1 A T 4: 40,177,848 I290F probably damaging Het
Cmip T A 8: 117,422,890 C155S probably damaging Het
Cyba G T 8: 122,426,979 P82T possibly damaging Het
Dgkb C T 12: 38,127,300 R202W possibly damaging Het
Dnah6 T C 6: 73,037,615 E3611G probably damaging Het
Dnah7b A T 1: 46,217,191 S1885C probably benign Het
Dopey2 A G 16: 93,763,410 E748G probably damaging Het
Dusp18 C A 11: 3,897,037 P9Q probably damaging Het
Fat4 T A 3: 38,888,864 D635E probably damaging Het
Fbxo25 T A 8: 13,921,886 S79R probably benign Het
Fgfr4 T A 13: 55,167,417 L675Q probably damaging Het
Foxo1 T A 3: 52,269,025 L75Q probably damaging Het
Fsip2 T C 2: 82,975,398 V687A possibly damaging Het
Gga3 G T 11: 115,588,431 P354Q probably damaging Het
Gm11077 A T 6: 140,729,322 K13N unknown Het
Haus4 T A 14: 54,549,775 K75M probably damaging Het
Igfn1 G A 1: 135,966,087 T2085M probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Lims1 A T 10: 58,416,670 I321L probably damaging Het
Ms4a6b A T 19: 11,521,680 I53F probably damaging Het
Msl3l2 A G 10: 56,115,572 D131G probably damaging Het
Nrap A G 19: 56,381,603 V189A probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pfkl T G 10: 77,997,589 I260L possibly damaging Het
Pkd2l1 A G 19: 44,157,732 Y128H probably benign Het
Prpf6 T A 2: 181,608,266 L73Q probably damaging Het
R3hdm2 T C 10: 127,485,447 V658A probably damaging Het
Rab27b T C 18: 69,996,155 T23A probably damaging Het
Rabif A G 1: 134,506,242 E98G probably damaging Het
Ror2 T C 13: 53,117,149 D378G possibly damaging Het
Spata21 A G 4: 141,107,185 T494A probably damaging Het
Ssh2 A G 11: 77,453,945 K919E probably benign Het
Tnrc6b C G 15: 80,879,565 P423A possibly damaging Het
Tsg101 A T 7: 46,891,120 D158E probably damaging Het
Tspo2 A G 17: 48,448,752 F93L probably benign Het
V1ra8 T A 6: 90,203,022 I69K probably damaging Het
Zan T C 5: 137,457,840 T1353A unknown Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp281 A G 1: 136,625,938 K218R possibly damaging Het
Other mutations in Tomm40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Tomm40 APN 7 19703363 missense probably benign 0.13
IGL01766:Tomm40 APN 7 19703082 missense possibly damaging 0.93
IGL02831:Tomm40 APN 7 19703089 missense probably damaging 1.00
IGL03178:Tomm40 APN 7 19701834 missense probably damaging 0.98
PIT4131001:Tomm40 UTSW 7 19703091 missense probably damaging 1.00
R0280:Tomm40 UTSW 7 19713751 missense probably damaging 1.00
R1842:Tomm40 UTSW 7 19713725 missense probably benign 0.41
R1913:Tomm40 UTSW 7 19710961 missense probably damaging 0.98
R3702:Tomm40 UTSW 7 19713673 missense possibly damaging 0.89
R4685:Tomm40 UTSW 7 19701836 missense probably benign 0.06
R5165:Tomm40 UTSW 7 19713667 critical splice donor site probably null
R6026:Tomm40 UTSW 7 19710964 missense probably benign 0.43
R6236:Tomm40 UTSW 7 19703356 missense probably benign 0.15
R6994:Tomm40 UTSW 7 19702906 missense probably damaging 0.98
R7206:Tomm40 UTSW 7 19710936 missense probably benign 0.10
R7530:Tomm40 UTSW 7 19702904 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ATCGAATGCCCTTCAGATCCC -3'
(R):5'- CGTTGTGGCTACCATAGAGATG -3'

Sequencing Primer
(F):5'- TGCCCTTCAGATCCCAGGAC -3'
(R):5'- ATGGGTGGCCAGGCACATC -3'
Posted On2016-08-04