Mutagenetix > Incidental Mutations

Incidental Mutation 'R5391:Sec16a'

425831

Institutional Source

Beutler Lab

Gene Symbol

Sec16a

Ensembl Gene

ENSMUSG00000026924

Gene Name

SEC16 homolog A, endoplasmic reticulum export factor

Synonyms

C230052J16Rik

MMRRC Submission

042963-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.954) question?

Stock #

R5391 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

26409431-26445216 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 26440032 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 657 (V657A)

Ref Sequence

ENSEMBL: ENSMUSP00000088796 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091252] [ENSMUST00000114082]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000091252
AA Change: V657A

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000088796
Gene: ENSMUSG00000026924
AA Change: V657A

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
low complexity region	204	221	N/A	INTRINSIC
low complexity region	243	254	N/A	INTRINSIC
low complexity region	371	382	N/A	INTRINSIC
low complexity region	537	561	N/A	INTRINSIC
low complexity region	608	621	N/A	INTRINSIC
low complexity region	760	777	N/A	INTRINSIC
low complexity region	1096	1105	N/A	INTRINSIC
low complexity region	1134	1150	N/A	INTRINSIC
low complexity region	1185	1195	N/A	INTRINSIC
low complexity region	1370	1392	N/A	INTRINSIC
Pfam:Sec16	1463	1565	3.1e-24	PFAM
low complexity region	1600	1614	N/A	INTRINSIC
Pfam:Sec16_C	1635	1898	2.3e-39	PFAM
low complexity region	2109	2124	N/A	INTRINSIC
low complexity region	2165	2177	N/A	INTRINSIC
low complexity region	2187	2197	N/A	INTRINSIC
low complexity region	2227	2242	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114082
AA Change: V657A

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000109716
Gene: ENSMUSG00000026924
AA Change: V657A

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
low complexity region	204	221	N/A	INTRINSIC
low complexity region	243	254	N/A	INTRINSIC
low complexity region	371	382	N/A	INTRINSIC
low complexity region	537	561	N/A	INTRINSIC
low complexity region	608	621	N/A	INTRINSIC
low complexity region	760	777	N/A	INTRINSIC
low complexity region	1096	1105	N/A	INTRINSIC
low complexity region	1134	1150	N/A	INTRINSIC
low complexity region	1185	1195	N/A	INTRINSIC
low complexity region	1370	1392	N/A	INTRINSIC
Pfam:Sec16	1464	1564	2.6e-10	PFAM
low complexity region	1600	1614	N/A	INTRINSIC
Pfam:Sec16_C	1636	1887	6.8e-45	PFAM
low complexity region	2109	2124	N/A	INTRINSIC
low complexity region	2165	2177	N/A	INTRINSIC
low complexity region	2187	2197	N/A	INTRINSIC
low complexity region	2227	2242	N/A	INTRINSIC
low complexity region	2310	2320	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000153996

SMART Domains

Protein: ENSMUSP00000121179
Gene: ENSMUSG00000026924

Domain	Start	End	E-Value	Type
low complexity region	12	29	N/A	INTRINSIC
low complexity region	116	125	N/A	INTRINSIC
low complexity region	154	170	N/A	INTRINSIC
low complexity region	205	215	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155252

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that forms part of the Sec16 complex. This protein has a role in protein transport from the endoplasmic reticulum (ER) to the Golgi and mediates COPII vesicle formation at the transitional ER. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Feb 2013]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	G	A	5: 8,805,481	M38I	probably null	Het
Actl7a	A	G	4: 56,743,661	T63A	probably benign	Het
Amfr	G	A	8: 93,976,048	P497S	probably damaging	Het
Ankrd33b	T	C	15: 31,325,206	I122V	probably damaging	Het
Asap1	G	T	15: 64,094,052	T1011K	possibly damaging	Het
Cbfa2t3	G	A	8: 122,633,395	R506*	probably null	Het
Ccdc105	G	A	10: 78,752,854	Q41*	probably null	Het
Ccs	C	G	19: 4,833,482	C96S	probably benign	Het
Cpt1a	A	G	19: 3,349,260	D20G	probably damaging	Het
Ctdspl2	G	A	2: 122,004,148		probably null	Het
Dhx57	T	C	17: 80,275,081	Y365C	probably damaging	Het
Dnah3	C	T	7: 120,090,076	M38I	probably benign	Het
Dnajc6	T	C	4: 101,628,158		probably null	Het
Elac2	A	G	11: 64,994,294	S450G	probably benign	Het
Gdf9	T	C	11: 53,433,797	V131A	probably benign	Het
Il12rb2	T	C	6: 67,292,420	N803S	probably benign	Het
Itgb4	T	A	11: 115,985,068	M477K	probably benign	Het
Itgb8	A	C	12: 119,170,741	C530W	probably damaging	Het
Krt78	C	A	15: 101,951,828	E218*	probably null	Het
Lpar1	A	G	4: 58,486,902	L105P	probably damaging	Het
Megf8	G	A	7: 25,340,289	G936D	possibly damaging	Het
Mov10	G	A	3: 104,802,533	H346Y	probably benign	Het
Nfia	A	G	4: 97,783,301	I83V	probably damaging	Het
Olfr1453	G	T	19: 13,027,786	A181E	probably damaging	Het
Olfr215	T	C	6: 116,582,847	Y33C	probably damaging	Het
Pcdhgb6	T	G	18: 37,742,587	I116S	probably damaging	Het
Pdcd6ip	G	T	9: 113,691,518	Q133K	probably damaging	Het
Phkb	A	G	8: 86,017,468	D582G	probably damaging	Het
Pik3cd	A	T	4: 149,659,131	V207E	probably damaging	Het
Ptov1	T	C	7: 44,863,584	Q397R	probably damaging	Het
Rangap1	A	G	15: 81,706,446	F482L	probably benign	Het
Rapgef1	T	A	2: 29,737,965	N1052K	probably damaging	Het
Rasl12	G	T	9: 65,398,667	A35S	probably damaging	Het
Rnf169	A	T	7: 99,935,160		probably null	Het
Sin3a	G	A	9: 57,105,673	R612H	probably damaging	Het
Six6	T	A	12: 72,941,701	L216*	probably null	Het
Tbce	T	C	13: 14,005,965	I293M	probably damaging	Het
Tmem176a	T	C	6: 48,844,696	L204P	probably damaging	Het
Tmem87a	A	G	2: 120,362,877		probably null	Het
Tns1	A	T	1: 73,990,409		probably null	Het
Usf3	T	A	16: 44,217,463	S769T	probably benign	Het
Vmn2r82	A	G	10: 79,356,657	T23A	probably null	Het
Vps26a	A	G	10: 62,456,747	*328Q	probably null	Het
Vps51	T	G	19: 6,071,033	E283D	probably benign	Het
Wwc2	A	T	8: 47,863,871	I729K	unknown	Het
Zbtb44	A	G	9: 31,053,305		probably null	Het
Zfp800	A	T	6: 28,242,993	S658T	probably damaging	Het
Zfp825	T	C	13: 74,480,546	T284A	possibly damaging	Het
Zfp935	G	T	13: 62,454,818	Y189*	probably null	Het
Zkscan1	T	A	5: 138,097,101	H203Q	probably benign	Het
Zkscan14	T	C	5: 145,195,794	D309G	probably benign	Het

Other mutations in Sec16a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Sec16a	APN	2	26439487	missense	probably benign	0.15
IGL00435:Sec16a	APN	2	26430101	missense	probably benign	0.00
IGL00469:Sec16a	APN	2	26428300	missense	probably damaging	1.00
IGL01622:Sec16a	APN	2	26438903	missense	probably benign	0.00
IGL01623:Sec16a	APN	2	26438903	missense	probably benign	0.00
IGL02158:Sec16a	APN	2	26416632	critical splice donor site	probably null
IGL02188:Sec16a	APN	2	26436008	missense	probably damaging	1.00
IGL02445:Sec16a	APN	2	26422040	missense	probably benign
IGL02568:Sec16a	APN	2	26436042	missense	probably damaging	1.00
IGL02710:Sec16a	APN	2	26430130	missense	possibly damaging	0.75
IGL02735:Sec16a	APN	2	26428137	splice site	probably benign
IGL02964:Sec16a	APN	2	26419723	missense	probably benign	0.00
IGL03027:Sec16a	APN	2	26423589	missense	probably benign	0.13
IGL03073:Sec16a	APN	2	26439183	missense	probably benign	0.02
IGL03297:Sec16a	APN	2	26439190	missense	probably benign	0.05
IGL03339:Sec16a	APN	2	26435933	missense	probably benign
H8562:Sec16a	UTSW	2	26441505	missense	probably benign
IGL03050:Sec16a	UTSW	2	26415747	missense	probably damaging	1.00
PIT4486001:Sec16a	UTSW	2	26425773	missense
R0039:Sec16a	UTSW	2	26423914	missense	probably benign	0.03
R0095:Sec16a	UTSW	2	26425760	splice site	probably null
R0095:Sec16a	UTSW	2	26425760	splice site	probably null
R0189:Sec16a	UTSW	2	26424414	splice site	probably null
R0255:Sec16a	UTSW	2	26431186	missense	probably damaging	0.97
R0278:Sec16a	UTSW	2	26428316	missense	probably damaging	1.00
R0739:Sec16a	UTSW	2	26441051	missense	possibly damaging	0.94
R0743:Sec16a	UTSW	2	26419722	missense	possibly damaging	0.67
R1446:Sec16a	UTSW	2	26423567	missense	probably benign	0.00
R1466:Sec16a	UTSW	2	26431157	missense	probably damaging	0.98
R1466:Sec16a	UTSW	2	26431157	missense	probably damaging	0.98
R1501:Sec16a	UTSW	2	26440045	missense	probably benign	0.16
R1524:Sec16a	UTSW	2	26428382	missense	probably damaging	1.00
R1584:Sec16a	UTSW	2	26431157	missense	probably damaging	0.98
R1649:Sec16a	UTSW	2	26425524	missense	probably damaging	1.00
R1744:Sec16a	UTSW	2	26439186	missense	probably damaging	1.00
R1959:Sec16a	UTSW	2	26430132	missense	probably benign	0.00
R1973:Sec16a	UTSW	2	26426489	missense	probably damaging	1.00
R2005:Sec16a	UTSW	2	26439080	missense	probably benign	0.27
R2073:Sec16a	UTSW	2	26440239	missense	probably damaging	1.00
R2074:Sec16a	UTSW	2	26440239	missense	probably damaging	1.00
R2075:Sec16a	UTSW	2	26440239	missense	probably damaging	1.00
R2151:Sec16a	UTSW	2	26413745	intron	probably benign
R2472:Sec16a	UTSW	2	26439936	missense	probably damaging	1.00
R2512:Sec16a	UTSW	2	26439025	missense	probably benign	0.00
R2520:Sec16a	UTSW	2	26441356	nonsense	probably null
R2571:Sec16a	UTSW	2	26439331	missense	probably benign	0.08
R3105:Sec16a	UTSW	2	26438421	missense	probably benign	0.14
R3508:Sec16a	UTSW	2	26425850	missense	probably damaging	1.00
R3809:Sec16a	UTSW	2	26441813	missense	possibly damaging	0.71
R3912:Sec16a	UTSW	2	26414387	missense	probably damaging	0.97
R4292:Sec16a	UTSW	2	26422155	missense	probably benign	0.01
R4293:Sec16a	UTSW	2	26422155	missense	probably benign	0.01
R4294:Sec16a	UTSW	2	26422155	missense	probably benign	0.01
R4576:Sec16a	UTSW	2	26431119	nonsense	probably null
R4611:Sec16a	UTSW	2	26441805	missense	probably benign	0.04
R4627:Sec16a	UTSW	2	26429393	missense	probably damaging	1.00
R4627:Sec16a	UTSW	2	26431068	unclassified	probably null
R4662:Sec16a	UTSW	2	26430570	missense	probably damaging	1.00
R4665:Sec16a	UTSW	2	26412958	intron	probably benign
R4906:Sec16a	UTSW	2	26441967	unclassified	probably benign
R4967:Sec16a	UTSW	2	26412871	missense	probably benign	0.00
R4983:Sec16a	UTSW	2	26439519	missense	probably benign
R5033:Sec16a	UTSW	2	26419649	missense	probably benign	0.00
R5251:Sec16a	UTSW	2	26439345	missense	probably benign	0.00
R5457:Sec16a	UTSW	2	26440268	missense	probably benign	0.01
R5530:Sec16a	UTSW	2	26439252	missense	probably benign	0.00
R5645:Sec16a	UTSW	2	26439895	missense	probably benign	0.01
R5661:Sec16a	UTSW	2	26439637	missense	probably benign	0.01
R5770:Sec16a	UTSW	2	26414390	missense	probably damaging	0.99
R5830:Sec16a	UTSW	2	26440841	missense	probably benign	0.15
R5866:Sec16a	UTSW	2	26419638	missense	probably benign	0.00
R5875:Sec16a	UTSW	2	26433367	missense	probably damaging	1.00
R5906:Sec16a	UTSW	2	26438831	missense	possibly damaging	0.63
R5922:Sec16a	UTSW	2	26415639	missense	probably benign	0.05
R6076:Sec16a	UTSW	2	26423942	missense	probably damaging	1.00
R6091:Sec16a	UTSW	2	26426470	missense	probably damaging	1.00
R6295:Sec16a	UTSW	2	26428241	missense	probably damaging	1.00
R6302:Sec16a	UTSW	2	26425805	missense	probably damaging	1.00
R6309:Sec16a	UTSW	2	26438571	missense	probably benign	0.00
R6459:Sec16a	UTSW	2	26423500	missense	probably benign	0.04
R6520:Sec16a	UTSW	2	26426106	missense	probably damaging	1.00
R6631:Sec16a	UTSW	2	26439957	missense	probably damaging	1.00
R6657:Sec16a	UTSW	2	26425864	nonsense	probably null
R6750:Sec16a	UTSW	2	26440018	missense	probably benign	0.00
R6852:Sec16a	UTSW	2	26441419	missense	probably damaging	0.99
R6860:Sec16a	UTSW	2	26430112	missense	probably damaging	1.00
R6967:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6968:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6970:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6991:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6993:Sec16a	UTSW	2	26423574	missense	probably damaging	0.99
R7009:Sec16a	UTSW	2	26436002	nonsense	probably null
R7057:Sec16a	UTSW	2	26425265	missense	probably damaging	1.00
R7186:Sec16a	UTSW	2	26440703	nonsense	probably null
R7227:Sec16a	UTSW	2	26438923	missense	probably benign	0.01
R7234:Sec16a	UTSW	2	26439768	missense	probably damaging	1.00
R7259:Sec16a	UTSW	2	26441592	missense	probably benign	0.00
R7326:Sec16a	UTSW	2	26439717	missense	unknown
R7371:Sec16a	UTSW	2	26441722	missense	probably benign
R7388:Sec16a	UTSW	2	26428364	missense
R7414:Sec16a	UTSW	2	26423631	missense
R7417:Sec16a	UTSW	2	26421397	missense
R7501:Sec16a	UTSW	2	26441851	missense	probably damaging	1.00
R7558:Sec16a	UTSW	2	26439734	missense
R7696:Sec16a	UTSW	2	26415633	critical splice donor site	probably null
X0011:Sec16a	UTSW	2	26415643	missense	probably damaging	1.00
X0034:Sec16a	UTSW	2	26416697	missense	probably benign	0.07
X0062:Sec16a	UTSW	2	26416697	missense	probably benign	0.07
Z1088:Sec16a	UTSW	2	26439093	missense	probably damaging	0.99
Z1176:Sec16a	UTSW	2	26438748	missense
Z1177:Sec16a	UTSW	2	26439321	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCTCTCACACTTCACAGGTC -3'
(R):5'- TGACTGGGAGCCAAAATTGC -3'

Sequencing Primer
(F):5'- ACAGTATCCAGGGGTGTCC -3'
(R):5'- GAGCCAAAATTGCTGCAGC -3'

Posted On

2016-08-04