Mutagenetix > Incidental Mutations

Incidental Mutation 'R0492:Kif13a'

42584

Institutional Source

Beutler Lab

Gene Symbol

Kif13a

Ensembl Gene

ENSMUSG00000021375

Gene Name

kinesin family member 13A

Synonyms

4930505I07Rik, N-3 kinesin

MMRRC Submission

038690-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.338) question?

Stock #

R0492 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46749087-46929867 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 46812742 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 400 (V400A)

Ref Sequence

ENSEMBL: ENSMUSP00000153614 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056978] [ENSMUST00000225591]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000056978
AA Change: V463A

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000055304
Gene: ENSMUSG00000021375
AA Change: V463A

Domain	Start	End	E-Value	Type
KISc	3	360	2.69e-175	SMART
low complexity region	368	381	N/A	INTRINSIC
low complexity region	391	406	N/A	INTRINSIC
FHA	469	519	7.16e-2	SMART
coiled coil region	605	639	N/A	INTRINSIC
coiled coil region	664	704	N/A	INTRINSIC
Pfam:KIF1B	748	792	1.7e-19	PFAM
low complexity region	840	854	N/A	INTRINSIC
low complexity region	903	915	N/A	INTRINSIC
Pfam:DUF3694	1003	1270	2.2e-39	PFAM
low complexity region	1401	1412	N/A	INTRINSIC
low complexity region	1475	1492	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000225591
AA Change: V400A

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)

Meta Mutation Damage Score

0.2366

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.7%

Validation Efficiency

99% (99/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of microtubule-based motor proteins that function in the positioning of endosomes. This family member can direct mannose-6-phosphate receptor-containing vesicles from the trans-Golgi network to the plasma membrane, and it is necessary for the steady-state distribution of late endosomes/lysosomes. It is also required for the translocation of FYVE-CENT and TTC19 from the centrosome to the midbody during cytokinesis, and it plays a role in melanosome maturation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased anxiety. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931409K22Rik	A	T	5: 24,554,628	L48Q	probably damaging	Het
Adgrb2	C	G	4: 130,007,831	P416R	probably damaging	Het
Adgre1	A	G	17: 57,402,742	D133G	unknown	Het
AI314180	A	G	4: 58,864,418	W288R	probably damaging	Het
Alpl	A	C	4: 137,749,576		probably null	Het
Ankrd65	T	C	4: 155,790,676		probably benign	Het
Baalc	A	T	15: 38,934,085		probably benign	Het
Bpifb5	A	G	2: 154,228,900	T204A	probably benign	Het
Bud31	A	G	5: 145,146,455	Y77C	probably damaging	Het
Capsl	A	G	15: 9,461,844		probably benign	Het
Ccna1	A	G	3: 55,048,583	V116A	probably damaging	Het
Cdc42bpa	C	A	1: 180,101,190	H723N	probably benign	Het
Cfap161	T	C	7: 83,794,037	I40V	possibly damaging	Het
CK137956	C	T	4: 127,951,300	V217I	probably benign	Het
Cog5	A	G	12: 31,869,461	T540A	probably damaging	Het
Cps1	T	C	1: 67,157,836	W349R	probably damaging	Het
Crispld2	G	T	8: 120,026,067	V285L	probably benign	Het
Crtc2	T	A	3: 90,263,497	F626I	probably damaging	Het
Daam1	G	A	12: 71,944,380	R256H	unknown	Het
Dhx38	G	T	8: 109,561,944		probably benign	Het
Dok4	G	A	8: 94,865,136	A324V	probably benign	Het
Dscam	T	C	16: 96,825,782		probably null	Het
Dusp16	A	T	6: 134,718,402	S489T	probably benign	Het
Erbin	A	T	13: 103,834,358	Y917N	probably damaging	Het
F13b	A	T	1: 139,522,559		probably null	Het
Fam26f	G	A	10: 34,127,651	R87*	probably null	Het
Fdx1	C	A	9: 51,963,425	A15S	probably benign	Het
Ffar4	A	T	19: 38,097,182	Q19L	probably benign	Het
Folh1	A	C	7: 86,746,192	V344G	probably damaging	Het
Fscb	T	A	12: 64,473,518	E391D	possibly damaging	Het
Gigyf2	G	A	1: 87,440,846	G1083R	probably damaging	Het
Gm14403	C	A	2: 177,508,566	H102N	probably benign	Het
Gm4847	A	G	1: 166,630,392	F464S	probably damaging	Het
Gpam	A	T	19: 55,096,179	M56K	possibly damaging	Het
Gpr165	T	A	X: 96,717,172	F352I	probably damaging	Het
Grik2	T	G	10: 49,101,164	I891L	probably damaging	Het
Gsr	T	C	8: 33,681,575		probably benign	Het
Hhla1	A	G	15: 65,936,291	F302L	probably benign	Het
Impg1	T	C	9: 80,345,308	D453G	possibly damaging	Het
Inpp5d	T	A	1: 87,698,150	V495E	possibly damaging	Het
Iqce	A	T	5: 140,675,235	L450H	probably damaging	Het
Itfg2	A	G	6: 128,413,523		probably null	Het
Kif7	T	C	7: 79,713,881	Y93C	probably damaging	Het
Krt33a	A	G	11: 100,016,083	V22A	probably benign	Het
Lct	T	C	1: 128,300,582	D1058G	probably damaging	Het
Lrp6	G	T	6: 134,480,518	D774E	possibly damaging	Het
Lrrc9	T	A	12: 72,478,763	S828R	possibly damaging	Het
Ly75	A	G	2: 60,308,276	W1416R	probably damaging	Het
Mdh2	T	C	5: 135,790,150	I320T	possibly damaging	Het
Med13l	T	A	5: 118,738,495	V912E	probably damaging	Het
Mgarp	T	C	3: 51,389,035	D182G	possibly damaging	Het
Mllt10	T	C	2: 18,146,887		probably benign	Het
Mmp28	G	A	11: 83,443,803	A375V	probably damaging	Het
Mrps23	T	A	11: 88,210,685	H133Q	probably benign	Het
Msh6	T	C	17: 87,975,251	S35P	probably benign	Het
Myo3a	A	G	2: 22,323,636	D347G	possibly damaging	Het
Npc1l1	T	C	11: 6,223,040	K800E	possibly damaging	Het
Olfr1034	T	C	2: 86,046,587	V35A	probably benign	Het
Olfr1034	T	C	2: 86,046,934	F151L	possibly damaging	Het
Olfr1086	G	A	2: 86,676,490	P281L	probably damaging	Het
Olfr152	T	G	2: 87,782,822	I94S	probably damaging	Het
Olfr414	T	A	1: 174,430,563	I45N	possibly damaging	Het
Olfr632	T	C	7: 103,937,764	I128T	probably benign	Het
Olfr695	A	T	7: 106,873,877	Y123N	probably damaging	Het
Osmr	A	C	15: 6,824,518	W570G	probably damaging	Het
Otol1	A	T	3: 70,027,784	I370F	probably damaging	Het
Pank2	A	G	2: 131,280,260	Y235C	probably damaging	Het
Pias2	T	C	18: 77,105,885	S187P	probably damaging	Het
Pkhd1l1	A	G	15: 44,519,690	N1115S	probably benign	Het
Pld1	G	T	3: 28,109,817	A800S	probably damaging	Het
Prex2	T	C	1: 11,186,633		probably benign	Het
Ptpn3	T	C	4: 57,194,304	Q908R	probably benign	Het
Rab3gap2	T	A	1: 185,252,392		probably benign	Het
Rbm24	A	T	13: 46,420,350	N82Y	probably damaging	Het
Rpl27	T	C	11: 101,445,255	V47A	possibly damaging	Het
Serpina1f	A	G	12: 103,693,567	V152A	possibly damaging	Het
Serpina5	A	G	12: 104,102,133	Y151C	probably damaging	Het
Serpinb7	A	G	1: 107,452,007	*381W	probably null	Het
Sh2b2	A	G	5: 136,232,263	F33S	probably damaging	Het
Slc22a2	A	C	17: 12,615,272	I476L	probably benign	Het
Slc6a12	A	T	6: 121,355,372	I222F	probably benign	Het
Smim26	G	A	2: 144,595,113	D61N	probably damaging	Het
Soat1	A	T	1: 156,441,354	Y209N	probably benign	Het
Sorl1	T	C	9: 41,991,371	H1630R	probably null	Het
Sptlc2	A	T	12: 87,346,806		probably null	Het
Strn3	G	A	12: 51,610,404	T642I	probably damaging	Het
Syce1l	T	A	8: 113,654,068	D137E	possibly damaging	Het
Syne2	T	C	12: 75,982,063		probably null	Het
Tcf25	C	A	8: 123,381,464	P86Q	probably benign	Het
Tmem19	A	T	10: 115,361,810	Y43*	probably null	Het
Tmem30b	T	C	12: 73,546,168	N58D	probably benign	Het
Tnn	A	C	1: 160,120,757	I795M	probably damaging	Het
Tnpo1	A	G	13: 98,855,446	Y641H	probably damaging	Het
Tra2a	A	T	6: 49,250,955		probably benign	Het
Trappc8	A	T	18: 20,866,186	F295I	probably benign	Het
Vmn2r101	T	A	17: 19,588,983	W125R	probably damaging	Het
Vps8	C	A	16: 21,442,357	F82L	probably damaging	Het
Ythdf2	A	T	4: 132,204,468	S460R	probably damaging	Het

Other mutations in Kif13a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01084:Kif13a	APN	13	46750634	splice site	probably benign
IGL01433:Kif13a	APN	13	46772908	missense	probably damaging	1.00
IGL01528:Kif13a	APN	13	46864837	splice site	probably benign
IGL01536:Kif13a	APN	13	46752289	missense	probably damaging	0.96
IGL01620:Kif13a	APN	13	46864820	missense	probably benign
IGL02020:Kif13a	APN	13	46794019	missense	probably benign	0.05
IGL02142:Kif13a	APN	13	46771535	missense	probably benign	0.04
IGL02375:Kif13a	APN	13	46825222	missense	probably damaging	1.00
IGL02407:Kif13a	APN	13	46785293	missense	probably damaging	0.99
IGL02476:Kif13a	APN	13	46785296	missense	probably damaging	1.00
IGL03038:Kif13a	APN	13	46772838	missense	probably damaging	1.00
IGL03053:Kif13a	APN	13	46752088	missense	probably benign	0.01
IGL03366:Kif13a	APN	13	46764623	missense	probably benign	0.00
R0025:Kif13a	UTSW	13	46786511	critical splice donor site	probably null
R0106:Kif13a	UTSW	13	46825347	splice site	probably benign
R0106:Kif13a	UTSW	13	46825347	splice site	probably benign
R0135:Kif13a	UTSW	13	46793943	missense	probably damaging	0.99
R0137:Kif13a	UTSW	13	46764603	missense	probably benign	0.38
R0243:Kif13a	UTSW	13	46791351	missense	probably benign	0.24
R0346:Kif13a	UTSW	13	46814219	missense	possibly damaging	0.95
R0403:Kif13a	UTSW	13	46791401	missense	probably damaging	1.00
R0607:Kif13a	UTSW	13	46802711	missense	probably damaging	0.96
R0631:Kif13a	UTSW	13	46778888	unclassified	probably benign
R0654:Kif13a	UTSW	13	46812742	missense	possibly damaging	0.93
R0697:Kif13a	UTSW	13	46848337	missense	probably benign	0.19
R0699:Kif13a	UTSW	13	46799213	missense	possibly damaging	0.92
R0715:Kif13a	UTSW	13	46812823	missense	probably damaging	0.98
R0834:Kif13a	UTSW	13	46814236	missense	probably damaging	0.96
R0903:Kif13a	UTSW	13	46929259	missense	possibly damaging	0.75
R1419:Kif13a	UTSW	13	46825235	missense	probably damaging	1.00
R1428:Kif13a	UTSW	13	46791511	splice site	probably benign
R1449:Kif13a	UTSW	13	46812736	missense	probably damaging	1.00
R1463:Kif13a	UTSW	13	46929612	missense	possibly damaging	0.75
R1541:Kif13a	UTSW	13	46809213	missense	probably benign
R1579:Kif13a	UTSW	13	46752856	missense	possibly damaging	0.93
R1582:Kif13a	UTSW	13	46793922	missense	probably benign	0.03
R1644:Kif13a	UTSW	13	46793922	missense	probably benign	0.31
R1752:Kif13a	UTSW	13	46798409	missense	probably damaging	1.00
R1755:Kif13a	UTSW	13	46752613	missense	possibly damaging	0.73
R1755:Kif13a	UTSW	13	46773678	missense	possibly damaging	0.50
R1858:Kif13a	UTSW	13	46864838	splice site	probably benign
R1891:Kif13a	UTSW	13	46929219	missense	possibly damaging	0.63
R1902:Kif13a	UTSW	13	46788162	missense	probably benign	0.00
R1928:Kif13a	UTSW	13	46812745	missense	probably damaging	1.00
R1960:Kif13a	UTSW	13	46864838	splice site	probably benign
R1961:Kif13a	UTSW	13	46864838	splice site	probably benign
R2016:Kif13a	UTSW	13	46810799	missense	probably benign	0.13
R2139:Kif13a	UTSW	13	46752469	missense	possibly damaging	0.92
R2174:Kif13a	UTSW	13	46769176	missense	probably damaging	0.99
R2407:Kif13a	UTSW	13	46777097	missense	probably damaging	1.00
R2504:Kif13a	UTSW	13	46814200	missense	probably damaging	1.00
R3122:Kif13a	UTSW	13	46764596	splice site	probably benign
R3499:Kif13a	UTSW	13	46825339	missense	probably damaging	1.00
R3905:Kif13a	UTSW	13	46802690	missense	probably damaging	1.00
R4474:Kif13a	UTSW	13	46814155	splice site	probably null
R4771:Kif13a	UTSW	13	46825211	missense	probably damaging	1.00
R4838:Kif13a	UTSW	13	46826748	missense	probably damaging	1.00
R4924:Kif13a	UTSW	13	46929599	missense	probably damaging	1.00
R4931:Kif13a	UTSW	13	46809055	missense	probably damaging	0.96
R4980:Kif13a	UTSW	13	46752746	missense	possibly damaging	0.76
R4992:Kif13a	UTSW	13	46777163	missense	probably damaging	0.96
R5047:Kif13a	UTSW	13	46788085	missense	probably benign	0.00
R5054:Kif13a	UTSW	13	46802646	missense	probably damaging	1.00
R5141:Kif13a	UTSW	13	46752721	missense	probably benign
R5329:Kif13a	UTSW	13	46775401	critical splice donor site	probably null
R5429:Kif13a	UTSW	13	46772769	critical splice donor site	probably null
R5499:Kif13a	UTSW	13	46832736	missense	probably damaging	1.00
R5509:Kif13a	UTSW	13	46752115	missense	probably benign	0.13
R5594:Kif13a	UTSW	13	46752862	missense	probably damaging	1.00
R5921:Kif13a	UTSW	13	46825300	missense	probably damaging	1.00
R5964:Kif13a	UTSW	13	46771524	missense	probably damaging	1.00
R6115:Kif13a	UTSW	13	46801313	missense	probably damaging	1.00
R6317:Kif13a	UTSW	13	46826757	missense	probably damaging	1.00
R6318:Kif13a	UTSW	13	46815207	splice site	probably null
R6393:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R6394:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R6395:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R6735:Kif13a	UTSW	13	46752746	missense	possibly damaging	0.76
R7037:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7038:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7039:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7237:Kif13a	UTSW	13	46809156	critical splice donor site	probably null
R7285:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7286:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7287:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7341:Kif13a	UTSW	13	46826745	missense	probably damaging	1.00
R7693:Kif13a	UTSW	13	46750613	missense	probably benign	0.01
R7761:Kif13a	UTSW	13	46798479	missense	probably benign
R8098:Kif13a	UTSW	13	46815304	missense	probably damaging	1.00
R8171:Kif13a	UTSW	13	46778968	missense	probably damaging	1.00
R8271:Kif13a	UTSW	13	46752581	missense	probably benign	0.01
X0013:Kif13a	UTSW	13	46929270	missense	possibly damaging	0.49

Predicted Primers

PCR Primer
(F):5'- TCCCCTCTGGAAACTGTCCTCAAG -3'
(R):5'- AGCCGACACTGTGTGTTTCACC -3'

Sequencing Primer
(F):5'- AACTGTCCTCAAGGGCATGG -3'
(R):5'- TGCGGCCCTTAGTAAACTCAG -3'

Posted On

2013-05-23