Incidental Mutation 'R0492:Kif13a'
ID42584
Institutional Source Beutler Lab
Gene Symbol Kif13a
Ensembl Gene ENSMUSG00000021375
Gene Namekinesin family member 13A
Synonyms4930505I07Rik, N-3 kinesin
MMRRC Submission 038690-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.412) question?
Stock #R0492 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location46749087-46929867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46812742 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 400 (V400A)
Ref Sequence ENSEMBL: ENSMUSP00000153614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056978] [ENSMUST00000225591]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056978
AA Change: V463A

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000055304
Gene: ENSMUSG00000021375
AA Change: V463A

DomainStartEndE-ValueType
KISc 3 360 2.69e-175 SMART
low complexity region 368 381 N/A INTRINSIC
low complexity region 391 406 N/A INTRINSIC
FHA 469 519 7.16e-2 SMART
coiled coil region 605 639 N/A INTRINSIC
coiled coil region 664 704 N/A INTRINSIC
Pfam:KIF1B 748 792 1.7e-19 PFAM
low complexity region 840 854 N/A INTRINSIC
low complexity region 903 915 N/A INTRINSIC
Pfam:DUF3694 1003 1270 2.2e-39 PFAM
low complexity region 1401 1412 N/A INTRINSIC
low complexity region 1475 1492 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000225591
AA Change: V400A

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.2366 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of microtubule-based motor proteins that function in the positioning of endosomes. This family member can direct mannose-6-phosphate receptor-containing vesicles from the trans-Golgi network to the plasma membrane, and it is necessary for the steady-state distribution of late endosomes/lysosomes. It is also required for the translocation of FYVE-CENT and TTC19 from the centrosome to the midbody during cytokinesis, and it plays a role in melanosome maturation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A T 5: 24,554,628 L48Q probably damaging Het
Adgrb2 C G 4: 130,007,831 P416R probably damaging Het
Adgre1 A G 17: 57,402,742 D133G unknown Het
AI314180 A G 4: 58,864,418 W288R probably damaging Het
Alpl A C 4: 137,749,576 probably null Het
Ankrd65 T C 4: 155,790,676 probably benign Het
Baalc A T 15: 38,934,085 probably benign Het
Bpifb5 A G 2: 154,228,900 T204A probably benign Het
Bud31 A G 5: 145,146,455 Y77C probably damaging Het
Capsl A G 15: 9,461,844 probably benign Het
Ccna1 A G 3: 55,048,583 V116A probably damaging Het
Cdc42bpa C A 1: 180,101,190 H723N probably benign Het
Cfap161 T C 7: 83,794,037 I40V possibly damaging Het
CK137956 C T 4: 127,951,300 V217I probably benign Het
Cog5 A G 12: 31,869,461 T540A probably damaging Het
Cps1 T C 1: 67,157,836 W349R probably damaging Het
Crispld2 G T 8: 120,026,067 V285L probably benign Het
Crtc2 T A 3: 90,263,497 F626I probably damaging Het
Daam1 G A 12: 71,944,380 R256H unknown Het
Dhx38 G T 8: 109,561,944 probably benign Het
Dok4 G A 8: 94,865,136 A324V probably benign Het
Dscam T C 16: 96,825,782 probably null Het
Dusp16 A T 6: 134,718,402 S489T probably benign Het
Erbin A T 13: 103,834,358 Y917N probably damaging Het
F13b A T 1: 139,522,559 probably null Het
Fam26f G A 10: 34,127,651 R87* probably null Het
Fdx1 C A 9: 51,963,425 A15S probably benign Het
Ffar4 A T 19: 38,097,182 Q19L probably benign Het
Folh1 A C 7: 86,746,192 V344G probably damaging Het
Fscb T A 12: 64,473,518 E391D possibly damaging Het
Gigyf2 G A 1: 87,440,846 G1083R probably damaging Het
Gm14403 C A 2: 177,508,566 H102N probably benign Het
Gm4847 A G 1: 166,630,392 F464S probably damaging Het
Gpam A T 19: 55,096,179 M56K possibly damaging Het
Gpr165 T A X: 96,717,172 F352I probably damaging Het
Grik2 T G 10: 49,101,164 I891L probably damaging Het
Gsr T C 8: 33,681,575 probably benign Het
Hhla1 A G 15: 65,936,291 F302L probably benign Het
Impg1 T C 9: 80,345,308 D453G possibly damaging Het
Inpp5d T A 1: 87,698,150 V495E possibly damaging Het
Iqce A T 5: 140,675,235 L450H probably damaging Het
Itfg2 A G 6: 128,413,523 probably null Het
Kif7 T C 7: 79,713,881 Y93C probably damaging Het
Krt33a A G 11: 100,016,083 V22A probably benign Het
Lct T C 1: 128,300,582 D1058G probably damaging Het
Lrp6 G T 6: 134,480,518 D774E possibly damaging Het
Lrrc9 T A 12: 72,478,763 S828R possibly damaging Het
Ly75 A G 2: 60,308,276 W1416R probably damaging Het
Mdh2 T C 5: 135,790,150 I320T possibly damaging Het
Med13l T A 5: 118,738,495 V912E probably damaging Het
Mgarp T C 3: 51,389,035 D182G possibly damaging Het
Mllt10 T C 2: 18,146,887 probably benign Het
Mmp28 G A 11: 83,443,803 A375V probably damaging Het
Mrps23 T A 11: 88,210,685 H133Q probably benign Het
Msh6 T C 17: 87,975,251 S35P probably benign Het
Myo3a A G 2: 22,323,636 D347G possibly damaging Het
Npc1l1 T C 11: 6,223,040 K800E possibly damaging Het
Olfr1034 T C 2: 86,046,587 V35A probably benign Het
Olfr1034 T C 2: 86,046,934 F151L possibly damaging Het
Olfr1086 G A 2: 86,676,490 P281L probably damaging Het
Olfr152 T G 2: 87,782,822 I94S probably damaging Het
Olfr414 T A 1: 174,430,563 I45N possibly damaging Het
Olfr632 T C 7: 103,937,764 I128T probably benign Het
Olfr695 A T 7: 106,873,877 Y123N probably damaging Het
Osmr A C 15: 6,824,518 W570G probably damaging Het
Otol1 A T 3: 70,027,784 I370F probably damaging Het
Pank2 A G 2: 131,280,260 Y235C probably damaging Het
Pias2 T C 18: 77,105,885 S187P probably damaging Het
Pkhd1l1 A G 15: 44,519,690 N1115S probably benign Het
Pld1 G T 3: 28,109,817 A800S probably damaging Het
Prex2 T C 1: 11,186,633 probably benign Het
Ptpn3 T C 4: 57,194,304 Q908R probably benign Het
Rab3gap2 T A 1: 185,252,392 probably benign Het
Rbm24 A T 13: 46,420,350 N82Y probably damaging Het
Rpl27 T C 11: 101,445,255 V47A possibly damaging Het
Serpina1f A G 12: 103,693,567 V152A possibly damaging Het
Serpina5 A G 12: 104,102,133 Y151C probably damaging Het
Serpinb7 A G 1: 107,452,007 *381W probably null Het
Sh2b2 A G 5: 136,232,263 F33S probably damaging Het
Slc22a2 A C 17: 12,615,272 I476L probably benign Het
Slc6a12 A T 6: 121,355,372 I222F probably benign Het
Smim26 G A 2: 144,595,113 D61N probably damaging Het
Soat1 A T 1: 156,441,354 Y209N probably benign Het
Sorl1 T C 9: 41,991,371 H1630R probably null Het
Sptlc2 A T 12: 87,346,806 probably null Het
Strn3 G A 12: 51,610,404 T642I probably damaging Het
Syce1l T A 8: 113,654,068 D137E possibly damaging Het
Syne2 T C 12: 75,982,063 probably null Het
Tcf25 C A 8: 123,381,464 P86Q probably benign Het
Tmem19 A T 10: 115,361,810 Y43* probably null Het
Tmem30b T C 12: 73,546,168 N58D probably benign Het
Tnn A C 1: 160,120,757 I795M probably damaging Het
Tnpo1 A G 13: 98,855,446 Y641H probably damaging Het
Tra2a A T 6: 49,250,955 probably benign Het
Trappc8 A T 18: 20,866,186 F295I probably benign Het
Vmn2r101 T A 17: 19,588,983 W125R probably damaging Het
Vps8 C A 16: 21,442,357 F82L probably damaging Het
Ythdf2 A T 4: 132,204,468 S460R probably damaging Het
Other mutations in Kif13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Kif13a APN 13 46750634 splice site probably benign
IGL01433:Kif13a APN 13 46772908 missense probably damaging 1.00
IGL01528:Kif13a APN 13 46864837 splice site probably benign
IGL01536:Kif13a APN 13 46752289 missense probably damaging 0.96
IGL01620:Kif13a APN 13 46864820 missense probably benign
IGL02020:Kif13a APN 13 46794019 missense probably benign 0.05
IGL02142:Kif13a APN 13 46771535 missense probably benign 0.04
IGL02375:Kif13a APN 13 46825222 missense probably damaging 1.00
IGL02407:Kif13a APN 13 46785293 missense probably damaging 0.99
IGL02476:Kif13a APN 13 46785296 missense probably damaging 1.00
IGL03038:Kif13a APN 13 46772838 missense probably damaging 1.00
IGL03053:Kif13a APN 13 46752088 missense probably benign 0.01
IGL03366:Kif13a APN 13 46764623 missense probably benign 0.00
R0025:Kif13a UTSW 13 46786511 critical splice donor site probably null
R0106:Kif13a UTSW 13 46825347 splice site probably benign
R0106:Kif13a UTSW 13 46825347 splice site probably benign
R0135:Kif13a UTSW 13 46793943 missense probably damaging 0.99
R0137:Kif13a UTSW 13 46764603 missense probably benign 0.38
R0243:Kif13a UTSW 13 46791351 missense probably benign 0.24
R0346:Kif13a UTSW 13 46814219 missense possibly damaging 0.95
R0403:Kif13a UTSW 13 46791401 missense probably damaging 1.00
R0607:Kif13a UTSW 13 46802711 missense probably damaging 0.96
R0631:Kif13a UTSW 13 46778888 unclassified probably benign
R0654:Kif13a UTSW 13 46812742 missense possibly damaging 0.93
R0697:Kif13a UTSW 13 46848337 missense probably benign 0.19
R0699:Kif13a UTSW 13 46799213 missense possibly damaging 0.92
R0715:Kif13a UTSW 13 46812823 missense probably damaging 0.98
R0834:Kif13a UTSW 13 46814236 missense probably damaging 0.96
R0903:Kif13a UTSW 13 46929259 missense possibly damaging 0.75
R1419:Kif13a UTSW 13 46825235 missense probably damaging 1.00
R1428:Kif13a UTSW 13 46791511 splice site probably benign
R1449:Kif13a UTSW 13 46812736 missense probably damaging 1.00
R1463:Kif13a UTSW 13 46929612 missense possibly damaging 0.75
R1541:Kif13a UTSW 13 46809213 missense probably benign
R1579:Kif13a UTSW 13 46752856 missense possibly damaging 0.93
R1582:Kif13a UTSW 13 46793922 missense probably benign 0.03
R1644:Kif13a UTSW 13 46793922 missense probably benign 0.31
R1752:Kif13a UTSW 13 46798409 missense probably damaging 1.00
R1755:Kif13a UTSW 13 46752613 missense possibly damaging 0.73
R1755:Kif13a UTSW 13 46773678 missense possibly damaging 0.50
R1858:Kif13a UTSW 13 46864838 splice site probably benign
R1891:Kif13a UTSW 13 46929219 missense possibly damaging 0.63
R1902:Kif13a UTSW 13 46788162 missense probably benign 0.00
R1928:Kif13a UTSW 13 46812745 missense probably damaging 1.00
R1960:Kif13a UTSW 13 46864838 splice site probably benign
R1961:Kif13a UTSW 13 46864838 splice site probably benign
R2016:Kif13a UTSW 13 46810799 missense probably benign 0.13
R2139:Kif13a UTSW 13 46752469 missense possibly damaging 0.92
R2174:Kif13a UTSW 13 46769176 missense probably damaging 0.99
R2407:Kif13a UTSW 13 46777097 missense probably damaging 1.00
R2504:Kif13a UTSW 13 46814200 missense probably damaging 1.00
R3122:Kif13a UTSW 13 46764596 splice site probably benign
R3499:Kif13a UTSW 13 46825339 missense probably damaging 1.00
R3905:Kif13a UTSW 13 46802690 missense probably damaging 1.00
R4474:Kif13a UTSW 13 46814155 splice site probably null
R4771:Kif13a UTSW 13 46825211 missense probably damaging 1.00
R4838:Kif13a UTSW 13 46826748 missense probably damaging 1.00
R4924:Kif13a UTSW 13 46929599 missense probably damaging 1.00
R4931:Kif13a UTSW 13 46809055 missense probably damaging 0.96
R4980:Kif13a UTSW 13 46752746 missense possibly damaging 0.76
R4992:Kif13a UTSW 13 46777163 missense probably damaging 0.96
R5047:Kif13a UTSW 13 46788085 missense probably benign 0.00
R5054:Kif13a UTSW 13 46802646 missense probably damaging 1.00
R5141:Kif13a UTSW 13 46752721 missense probably benign
R5329:Kif13a UTSW 13 46775401 critical splice donor site probably null
R5429:Kif13a UTSW 13 46772769 critical splice donor site probably null
R5499:Kif13a UTSW 13 46832736 missense probably damaging 1.00
R5509:Kif13a UTSW 13 46752115 missense probably benign 0.13
R5594:Kif13a UTSW 13 46752862 missense probably damaging 1.00
R5921:Kif13a UTSW 13 46825300 missense probably damaging 1.00
R5964:Kif13a UTSW 13 46771524 missense probably damaging 1.00
R6115:Kif13a UTSW 13 46801313 missense probably damaging 1.00
R6317:Kif13a UTSW 13 46826757 missense probably damaging 1.00
R6318:Kif13a UTSW 13 46815207 splice site probably null
R6393:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R6394:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R6395:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R6735:Kif13a UTSW 13 46752746 missense possibly damaging 0.76
R7037:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7038:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7039:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7237:Kif13a UTSW 13 46809156 critical splice donor site probably null
R7285:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7286:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7287:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7341:Kif13a UTSW 13 46826745 missense probably damaging 1.00
R7693:Kif13a UTSW 13 46750613 missense probably benign 0.01
R7761:Kif13a UTSW 13 46798479 missense probably benign
X0013:Kif13a UTSW 13 46929270 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TCCCCTCTGGAAACTGTCCTCAAG -3'
(R):5'- AGCCGACACTGTGTGTTTCACC -3'

Sequencing Primer
(F):5'- AACTGTCCTCAAGGGCATGG -3'
(R):5'- TGCGGCCCTTAGTAAACTCAG -3'
Posted On2013-05-23