Incidental Mutation 'R5392:Olfr353'
List |< first << previous [record 25 of 41] next >> last >|
ID425888
Institutional Source Beutler Lab
Gene Symbol Olfr353
Ensembl Gene ENSMUSG00000075382
Gene Nameolfactory receptor 353
SynonymsGA_x6K02T2NLDC-33585366-33584431, MOR127-3
MMRRC Submission 042964-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R5392 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location36887293-36892936 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36890674 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 58 (Y58F)
Ref Sequence ENSEMBL: ENSMUSP00000149378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100149] [ENSMUST00000215925] [ENSMUST00000217215]
Predicted Effect probably benign
Transcript: ENSMUST00000100149
AA Change: Y58F

PolyPhen 2 Score 0.335 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097726
Gene: ENSMUSG00000075382
AA Change: Y58F

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.3e-56 PFAM
Pfam:7tm_1 39 288 3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215925
AA Change: Y58F

PolyPhen 2 Score 0.335 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000217215
AA Change: Y58F

PolyPhen 2 Score 0.335 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T C 2: 128,010,168 probably null Het
Acyp1 T C 12: 85,278,985 probably benign Het
Ces1b G A 8: 93,071,962 R199C probably damaging Het
Col6a3 C A 1: 90,801,295 R1308L probably benign Het
Cpa5 C T 6: 30,630,830 Q364* probably null Het
Cyth4 T A 15: 78,606,985 L88Q probably damaging Het
Dock7 A G 4: 99,008,006 V59A probably damaging Het
Drd2 A G 9: 49,395,628 N5D possibly damaging Het
Epsti1 T C 14: 77,986,744 I272T probably benign Het
Fndc3b A T 3: 27,465,787 C568* probably null Het
Frmd4a C T 2: 4,594,573 A161V probably damaging Het
Gfpt1 A G 6: 87,077,157 T465A probably damaging Het
Hecw1 C A 13: 14,245,762 Q1025H probably damaging Het
Irak4 A T 15: 94,556,684 M237L probably benign Het
Irak4 T C 15: 94,556,685 M237T probably benign Het
Kdsr T A 1: 106,753,241 I76F possibly damaging Het
Kif15 T C 9: 122,996,295 F533S probably damaging Het
Kmt5b T C 19: 3,802,127 F103L possibly damaging Het
Krtcap2 C T 3: 89,246,879 L36F probably benign Het
Mroh7 A G 4: 106,711,251 probably null Het
Mta1 T C 12: 113,133,236 V559A probably benign Het
N4bp1 A G 8: 86,860,420 probably null Het
Oas1d T C 5: 120,916,940 S192P possibly damaging Het
Olfr215 A G 6: 116,582,418 F176S probably damaging Het
Olfr809 A G 10: 129,776,315 I149V probably benign Het
Rabgap1 T A 2: 37,469,489 N21K probably damaging Het
Rad9b A T 5: 122,351,578 C25S probably damaging Het
Spg7 T C 8: 123,087,363 S454P probably damaging Het
Spink2 T A 5: 77,207,025 H40L probably benign Het
Syne1 T A 10: 5,348,661 D1082V probably damaging Het
Syt2 A G 1: 134,744,021 D179G probably damaging Het
Tm7sf2 T C 19: 6,063,968 D181G probably damaging Het
Vmn1r174 A G 7: 23,754,802 I298V unknown Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Vps9d1 T C 8: 123,254,013 E25G probably damaging Het
Zfp119a T C 17: 55,866,328 R172G probably benign Het
Zfp51 A T 17: 21,465,322 Y733F possibly damaging Het
Zfp658 A C 7: 43,572,931 E210A probably benign Het
Zp2 C A 7: 120,135,764 E433* probably null Het
Other mutations in Olfr353
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02706:Olfr353 APN 2 36890719 missense probably damaging 1.00
IGL02944:Olfr353 APN 2 36890788 missense possibly damaging 0.83
R0101:Olfr353 UTSW 2 36890126 missense probably damaging 1.00
R0118:Olfr353 UTSW 2 36890023 missense probably benign 0.07
R0276:Olfr353 UTSW 2 36890023 missense probably benign 0.26
R0944:Olfr353 UTSW 2 36890686 missense probably damaging 1.00
R0975:Olfr353 UTSW 2 36890550 missense possibly damaging 0.52
R1895:Olfr353 UTSW 2 36890446 missense possibly damaging 0.92
R1946:Olfr353 UTSW 2 36890446 missense possibly damaging 0.92
R2847:Olfr353 UTSW 2 36890524 missense probably damaging 1.00
R4573:Olfr353 UTSW 2 36890190 missense probably damaging 1.00
R4631:Olfr353 UTSW 2 36890618 missense probably benign 0.01
R4647:Olfr353 UTSW 2 36890651 missense probably benign 0.00
R4918:Olfr353 UTSW 2 36890332 missense probably damaging 0.98
R4967:Olfr353 UTSW 2 36890707 missense probably damaging 1.00
R5102:Olfr353 UTSW 2 36890044 missense possibly damaging 0.87
R5188:Olfr353 UTSW 2 36890393 missense probably benign
R5608:Olfr353 UTSW 2 36890515 missense probably damaging 1.00
R6527:Olfr353 UTSW 2 36890582 missense probably benign 0.02
R8508:Olfr353 UTSW 2 36890354 missense probably damaging 1.00
X0017:Olfr353 UTSW 2 36889987 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCCAGGAAGAAGCTGTC -3'
(R):5'- TGCAAATCAACTCTGCATTCTG -3'

Sequencing Primer
(F):5'- CCAGGAAGAAGCTGTCCAGATC -3'
(R):5'- CTACAGATGCTCTAGACTCATGG -3'
Posted On2016-08-04