Incidental Mutation 'R5392:Acoxl'
List [record 1 of 41] next >> last >|
ID425890
Institutional Source Beutler Lab
Gene Symbol Acoxl
Ensembl Gene ENSMUSG00000027380
Gene Nameacyl-Coenzyme A oxidase-like
Synonyms1200014P05Rik
MMRRC Submission 042964-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5392 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location127838876-128123873 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 128010168 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028859] [ENSMUST00000110344]
Predicted Effect probably null
Transcript: ENSMUST00000028859
SMART Domains Protein: ENSMUSP00000028859
Gene: ENSMUSG00000027380

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 115 223 7.2e-19 PFAM
Pfam:Acyl-CoA_dh_1 254 416 1.8e-14 PFAM
Pfam:ACOX 458 599 6.8e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110344
SMART Domains Protein: ENSMUSP00000105973
Gene: ENSMUSG00000027380

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_1 1 136 1.2e-9 PFAM
Pfam:ACOX 175 319 1.5e-18 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp1 T C 12: 85,278,985 probably benign Het
Ces1b G A 8: 93,071,962 R199C probably damaging Het
Col6a3 C A 1: 90,801,295 R1308L probably benign Het
Cpa5 C T 6: 30,630,830 Q364* probably null Het
Cyth4 T A 15: 78,606,985 L88Q probably damaging Het
Dock7 A G 4: 99,008,006 V59A probably damaging Het
Drd2 A G 9: 49,395,628 N5D possibly damaging Het
Epsti1 T C 14: 77,986,744 I272T probably benign Het
Fndc3b A T 3: 27,465,787 C568* probably null Het
Frmd4a C T 2: 4,594,573 A161V probably damaging Het
Gfpt1 A G 6: 87,077,157 T465A probably damaging Het
Hecw1 C A 13: 14,245,762 Q1025H probably damaging Het
Irak4 A T 15: 94,556,684 M237L probably benign Het
Irak4 T C 15: 94,556,685 M237T probably benign Het
Kdsr T A 1: 106,753,241 I76F possibly damaging Het
Kif15 T C 9: 122,996,295 F533S probably damaging Het
Kmt5b T C 19: 3,802,127 F103L possibly damaging Het
Krtcap2 C T 3: 89,246,879 L36F probably benign Het
Mroh7 A G 4: 106,711,251 probably null Het
Mta1 T C 12: 113,133,236 V559A probably benign Het
N4bp1 A G 8: 86,860,420 probably null Het
Oas1d T C 5: 120,916,940 S192P possibly damaging Het
Olfr215 A G 6: 116,582,418 F176S probably damaging Het
Olfr353 T A 2: 36,890,674 Y58F probably benign Het
Olfr809 A G 10: 129,776,315 I149V probably benign Het
Rabgap1 T A 2: 37,469,489 N21K probably damaging Het
Rad9b A T 5: 122,351,578 C25S probably damaging Het
Spg7 T C 8: 123,087,363 S454P probably damaging Het
Spink2 T A 5: 77,207,025 H40L probably benign Het
Syne1 T A 10: 5,348,661 D1082V probably damaging Het
Syt2 A G 1: 134,744,021 D179G probably damaging Het
Tm7sf2 T C 19: 6,063,968 D181G probably damaging Het
Vmn1r174 A G 7: 23,754,802 I298V unknown Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Vps9d1 T C 8: 123,254,013 E25G probably damaging Het
Zfp119a T C 17: 55,866,328 R172G probably benign Het
Zfp51 A T 17: 21,465,322 Y733F possibly damaging Het
Zfp658 A C 7: 43,572,931 E210A probably benign Het
Zp2 C A 7: 120,135,764 E433* probably null Het
Other mutations in Acoxl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Acoxl APN 2 127978804 missense probably damaging 1.00
IGL01397:Acoxl APN 2 128034891 missense possibly damaging 0.67
IGL02502:Acoxl APN 2 128075884 missense probably damaging 1.00
gulch UTSW 2 128123024 missense probably benign 0.02
Gully UTSW 2 128044391 missense possibly damaging 0.62
P4748:Acoxl UTSW 2 128086344 splice site probably benign
R0450:Acoxl UTSW 2 127880503 splice site probably null
R0469:Acoxl UTSW 2 127880503 splice site probably null
R0510:Acoxl UTSW 2 127880503 splice site probably null
R1257:Acoxl UTSW 2 128044366 missense probably benign 0.01
R1703:Acoxl UTSW 2 127978772 missense probably damaging 0.99
R1726:Acoxl UTSW 2 127880446 missense probably damaging 1.00
R1867:Acoxl UTSW 2 127877787 missense probably damaging 1.00
R2103:Acoxl UTSW 2 127972606 missense probably damaging 0.97
R2168:Acoxl UTSW 2 127878781 missense probably damaging 1.00
R2761:Acoxl UTSW 2 127877813 missense probably benign 0.01
R3895:Acoxl UTSW 2 127972525 splice site probably benign
R4370:Acoxl UTSW 2 127878788 missense possibly damaging 0.95
R4571:Acoxl UTSW 2 127877807 missense probably damaging 1.00
R4727:Acoxl UTSW 2 127978738 missense probably damaging 1.00
R4851:Acoxl UTSW 2 128044391 missense possibly damaging 0.62
R4962:Acoxl UTSW 2 128075890 missense probably damaging 0.98
R5248:Acoxl UTSW 2 128075935 critical splice donor site probably null
R5411:Acoxl UTSW 2 127854901 missense probably benign 0.00
R5418:Acoxl UTSW 2 127877802 missense probably benign 0.34
R5507:Acoxl UTSW 2 127884474 missense probably damaging 0.99
R5681:Acoxl UTSW 2 127972639 missense possibly damaging 0.93
R5738:Acoxl UTSW 2 127877766 missense probably benign 0.21
R6325:Acoxl UTSW 2 128123024 missense probably benign 0.02
R6800:Acoxl UTSW 2 128010165 missense probably damaging 1.00
R7027:Acoxl UTSW 2 128010083 missense probably benign
R7098:Acoxl UTSW 2 127854915 nonsense probably null
R7165:Acoxl UTSW 2 128123108 missense probably benign
R7395:Acoxl UTSW 2 127884416 missense probably damaging 1.00
R7697:Acoxl UTSW 2 127978782 missense probably benign 0.01
Z1088:Acoxl UTSW 2 127872195 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTGACCTCAAAGCTAATGTG -3'
(R):5'- TCTGACTTAGTACATGCTAGTGG -3'

Sequencing Primer
(F):5'- TTTTCCTCTTCAATGATCTGTGC -3'
(R):5'- GACTTAGTACATGCTAGTGGTTTTC -3'
Posted On2016-08-04