Incidental Mutation 'R5392:Fndc3b'
List |< first << previous [record 10 of 41] next >> last >|
ID425891
Institutional Source Beutler Lab
Gene Symbol Fndc3b
Ensembl Gene ENSMUSG00000039286
Gene Namefibronectin type III domain containing 3B
Synonymsfad104, 1600019O04Rik
MMRRC Submission 042964-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5392 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location27416162-27711307 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 27465787 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 568 (C568*)
Ref Sequence ENSEMBL: ENSMUSP00000141620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046157] [ENSMUST00000195008]
Predicted Effect probably null
Transcript: ENSMUST00000046157
AA Change: C568*
SMART Domains Protein: ENSMUSP00000041495
Gene: ENSMUSG00000039286
AA Change: C568*

DomainStartEndE-ValueType
low complexity region 119 132 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
low complexity region 224 246 N/A INTRINSIC
FN3 279 368 6.29e-8 SMART
FN3 382 463 8.31e-8 SMART
FN3 478 560 3.15e-8 SMART
FN3 575 659 4.28e-10 SMART
FN3 674 755 2.14e-10 SMART
FN3 770 849 1.98e-5 SMART
FN3 872 947 1.31e-5 SMART
FN3 961 1042 2.31e-6 SMART
FN3 1057 1137 1.2e-4 SMART
low complexity region 1165 1176 N/A INTRINSIC
transmembrane domain 1182 1204 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000195008
AA Change: C568*
SMART Domains Protein: ENSMUSP00000141620
Gene: ENSMUSG00000039286
AA Change: C568*

DomainStartEndE-ValueType
low complexity region 119 132 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
low complexity region 224 246 N/A INTRINSIC
FN3 279 368 6.29e-8 SMART
FN3 382 463 8.31e-8 SMART
FN3 478 560 3.15e-8 SMART
FN3 575 659 4.28e-10 SMART
FN3 674 755 2.14e-10 SMART
FN3 770 849 1.98e-5 SMART
FN3 872 947 1.31e-5 SMART
FN3 961 1042 2.31e-6 SMART
FN3 1057 1137 1.2e-4 SMART
low complexity region 1165 1176 N/A INTRINSIC
transmembrane domain 1182 1204 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die shortly after birth despite normal energy homeostasis. Mouse embryonic fibroblasts homozygous for a knock-out allele exhibit impaired adipogenesis and enhanced osteogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T C 2: 128,010,168 probably null Het
Acyp1 T C 12: 85,278,985 probably benign Het
Ces1b G A 8: 93,071,962 R199C probably damaging Het
Col6a3 C A 1: 90,801,295 R1308L probably benign Het
Cpa5 C T 6: 30,630,830 Q364* probably null Het
Cyth4 T A 15: 78,606,985 L88Q probably damaging Het
Dock7 A G 4: 99,008,006 V59A probably damaging Het
Drd2 A G 9: 49,395,628 N5D possibly damaging Het
Epsti1 T C 14: 77,986,744 I272T probably benign Het
Frmd4a C T 2: 4,594,573 A161V probably damaging Het
Gfpt1 A G 6: 87,077,157 T465A probably damaging Het
Hecw1 C A 13: 14,245,762 Q1025H probably damaging Het
Irak4 A T 15: 94,556,684 M237L probably benign Het
Irak4 T C 15: 94,556,685 M237T probably benign Het
Kdsr T A 1: 106,753,241 I76F possibly damaging Het
Kif15 T C 9: 122,996,295 F533S probably damaging Het
Kmt5b T C 19: 3,802,127 F103L possibly damaging Het
Krtcap2 C T 3: 89,246,879 L36F probably benign Het
Mroh7 A G 4: 106,711,251 probably null Het
Mta1 T C 12: 113,133,236 V559A probably benign Het
N4bp1 A G 8: 86,860,420 probably null Het
Oas1d T C 5: 120,916,940 S192P possibly damaging Het
Olfr215 A G 6: 116,582,418 F176S probably damaging Het
Olfr353 T A 2: 36,890,674 Y58F probably benign Het
Olfr809 A G 10: 129,776,315 I149V probably benign Het
Rabgap1 T A 2: 37,469,489 N21K probably damaging Het
Rad9b A T 5: 122,351,578 C25S probably damaging Het
Spg7 T C 8: 123,087,363 S454P probably damaging Het
Spink2 T A 5: 77,207,025 H40L probably benign Het
Syne1 T A 10: 5,348,661 D1082V probably damaging Het
Syt2 A G 1: 134,744,021 D179G probably damaging Het
Tm7sf2 T C 19: 6,063,968 D181G probably damaging Het
Vmn1r174 A G 7: 23,754,802 I298V unknown Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Vps9d1 T C 8: 123,254,013 E25G probably damaging Het
Zfp119a T C 17: 55,866,328 R172G probably benign Het
Zfp51 A T 17: 21,465,322 Y733F possibly damaging Het
Zfp658 A C 7: 43,572,931 E210A probably benign Het
Zp2 C A 7: 120,135,764 E433* probably null Het
Other mutations in Fndc3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Fndc3b APN 3 27538012 missense probably benign 0.40
IGL00848:Fndc3b APN 3 27451509 missense probably damaging 1.00
IGL01099:Fndc3b APN 3 27463817 missense probably benign 0.10
IGL01459:Fndc3b APN 3 27461740 missense probably benign 0.11
IGL01583:Fndc3b APN 3 27428995 missense probably damaging 1.00
IGL01736:Fndc3b APN 3 27467403 missense probably damaging 1.00
IGL02154:Fndc3b APN 3 27538117 missense probably damaging 0.99
IGL02377:Fndc3b APN 3 27620652 missense probably damaging 1.00
IGL02470:Fndc3b APN 3 27461720 missense probably damaging 1.00
IGL02508:Fndc3b APN 3 27458751 missense probably damaging 1.00
IGL02834:Fndc3b APN 3 27508503 missense probably damaging 1.00
IGL02974:Fndc3b APN 3 27488276 missense probably damaging 1.00
IGL02999:Fndc3b APN 3 27538239 missense probably damaging 1.00
IGL03083:Fndc3b APN 3 27467427 missense probably benign 0.10
R0040:Fndc3b UTSW 3 27556117 splice site probably null
R0040:Fndc3b UTSW 3 27556117 splice site probably null
R0101:Fndc3b UTSW 3 27458808 missense probably damaging 1.00
R0279:Fndc3b UTSW 3 27457006 missense probably benign 0.30
R0281:Fndc3b UTSW 3 27457006 missense probably benign 0.30
R0325:Fndc3b UTSW 3 27467430 missense probably damaging 1.00
R0398:Fndc3b UTSW 3 27461779 missense probably benign 0.19
R1334:Fndc3b UTSW 3 27458851 missense probably damaging 1.00
R1464:Fndc3b UTSW 3 27440185 splice site probably benign
R1961:Fndc3b UTSW 3 27456451 nonsense probably null
R1993:Fndc3b UTSW 3 27419400 missense probably benign
R2087:Fndc3b UTSW 3 27451554 missense probably benign 0.00
R2113:Fndc3b UTSW 3 27643036 missense probably damaging 1.00
R2258:Fndc3b UTSW 3 27440160 missense possibly damaging 0.93
R2437:Fndc3b UTSW 3 27451332 missense probably damaging 0.99
R2930:Fndc3b UTSW 3 27470286 missense probably benign
R2997:Fndc3b UTSW 3 27468872 missense probably benign 0.00
R3151:Fndc3b UTSW 3 27419503 missense possibly damaging 0.93
R3782:Fndc3b UTSW 3 27459986 missense possibly damaging 0.81
R4255:Fndc3b UTSW 3 27501407 missense possibly damaging 0.77
R4628:Fndc3b UTSW 3 27556128 missense probably benign 0.19
R4747:Fndc3b UTSW 3 27428965 missense probably damaging 0.98
R4849:Fndc3b UTSW 3 27459948 missense probably damaging 1.00
R5185:Fndc3b UTSW 3 27457070 missense probably benign 0.14
R5291:Fndc3b UTSW 3 27642995 missense probably benign 0.39
R5540:Fndc3b UTSW 3 27501502 missense probably damaging 1.00
R5554:Fndc3b UTSW 3 27643013 missense possibly damaging 0.69
R5635:Fndc3b UTSW 3 27541931 missense probably damaging 1.00
R5639:Fndc3b UTSW 3 27426153 missense probably damaging 0.98
R5678:Fndc3b UTSW 3 27429023 missense probably benign
R5732:Fndc3b UTSW 3 27461773 missense probably damaging 1.00
R5880:Fndc3b UTSW 3 27428903 missense probably damaging 1.00
R6539:Fndc3b UTSW 3 27538057 missense probably benign 0.22
R7038:Fndc3b UTSW 3 27501469 missense probably benign 0.23
R7102:Fndc3b UTSW 3 27470234 missense possibly damaging 0.73
R7203:Fndc3b UTSW 3 27456485 missense probably benign 0.00
R7472:Fndc3b UTSW 3 27461744 missense probably benign 0.00
R7796:Fndc3b UTSW 3 27461743 missense probably benign 0.00
R7861:Fndc3b UTSW 3 27468999 missense possibly damaging 0.62
R8105:Fndc3b UTSW 3 27470225 missense probably benign 0.01
R8119:Fndc3b UTSW 3 27451344 missense probably benign 0.01
X0028:Fndc3b UTSW 3 27451434 missense possibly damaging 0.72
Z1088:Fndc3b UTSW 3 27465808 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ATTAACATTCAGTGCCCCTCCAG -3'
(R):5'- CATTGAAATCAGCAGTCTCAAGAC -3'

Sequencing Primer
(F):5'- GCCCTCACAAATGTCTAATAAATGC -3'
(R):5'- TCTCAAGACAAGTGACTGGGTC -3'
Posted On2016-08-04