Incidental Mutation 'R5392:Krtcap2'
ID425892
Institutional Source Beutler Lab
Gene Symbol Krtcap2
Ensembl Gene ENSMUSG00000042747
Gene Namekeratinocyte associated protein 2
Synonyms0610010I12Rik
MMRRC Submission 042964-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R5392 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location89245966-89249906 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89246879 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 36 (L36F)
Ref Sequence ENSEMBL: ENSMUSP00000043540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040888] [ENSMUST00000041022] [ENSMUST00000090924] [ENSMUST00000107464] [ENSMUST00000125952] [ENSMUST00000143637] [ENSMUST00000168900]
Predicted Effect probably benign
Transcript: ENSMUST00000040888
AA Change: L36F

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000043540
Gene: ENSMUSG00000042747
AA Change: L36F

DomainStartEndE-ValueType
Pfam:Keratin_assoc 87 215 2.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041022
SMART Domains Protein: ENSMUSP00000036053
Gene: ENSMUSG00000042766

DomainStartEndE-ValueType
RING 33 133 1.92e-6 SMART
BBOX 222 263 9.59e-7 SMART
Blast:BBC 271 395 3e-13 BLAST
FN3 430 515 2.03e-2 SMART
low complexity region 561 571 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090924
SMART Domains Protein: ENSMUSP00000088442
Gene: ENSMUSG00000042766

DomainStartEndE-ValueType
RING 20 120 1.92e-6 SMART
BBOX 209 250 9.59e-7 SMART
Blast:BBC 258 382 8e-13 BLAST
FN3 417 502 2.03e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107464
SMART Domains Protein: ENSMUSP00000103088
Gene: ENSMUSG00000042766

DomainStartEndE-ValueType
RING 10 110 1.92e-6 SMART
BBOX 199 240 9.59e-7 SMART
Blast:BBC 248 372 2e-13 BLAST
FN3 407 492 2.03e-2 SMART
low complexity region 538 548 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132818
Predicted Effect probably benign
Transcript: ENSMUST00000143637
SMART Domains Protein: ENSMUSP00000119270
Gene: ENSMUSG00000042766

DomainStartEndE-ValueType
RING 33 133 1.92e-6 SMART
BBOX 222 263 9.59e-7 SMART
Blast:BBC 270 391 4e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000168900
AA Change: L14F

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000130372
Gene: ENSMUSG00000042747
AA Change: L14F

DomainStartEndE-ValueType
Pfam:Keratin_assoc 1 134 1.2e-61 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T C 2: 128,010,168 probably null Het
Acyp1 T C 12: 85,278,985 probably benign Het
Ces1b G A 8: 93,071,962 R199C probably damaging Het
Col6a3 C A 1: 90,801,295 R1308L probably benign Het
Cpa5 C T 6: 30,630,830 Q364* probably null Het
Cyth4 T A 15: 78,606,985 L88Q probably damaging Het
Dock7 A G 4: 99,008,006 V59A probably damaging Het
Drd2 A G 9: 49,395,628 N5D possibly damaging Het
Epsti1 T C 14: 77,986,744 I272T probably benign Het
Fndc3b A T 3: 27,465,787 C568* probably null Het
Frmd4a C T 2: 4,594,573 A161V probably damaging Het
Gfpt1 A G 6: 87,077,157 T465A probably damaging Het
Hecw1 C A 13: 14,245,762 Q1025H probably damaging Het
Irak4 A T 15: 94,556,684 M237L probably benign Het
Irak4 T C 15: 94,556,685 M237T probably benign Het
Kdsr T A 1: 106,753,241 I76F possibly damaging Het
Kif15 T C 9: 122,996,295 F533S probably damaging Het
Kmt5b T C 19: 3,802,127 F103L possibly damaging Het
Mroh7 A G 4: 106,711,251 probably null Het
Mta1 T C 12: 113,133,236 V559A probably benign Het
N4bp1 A G 8: 86,860,420 probably null Het
Oas1d T C 5: 120,916,940 S192P possibly damaging Het
Olfr215 A G 6: 116,582,418 F176S probably damaging Het
Olfr353 T A 2: 36,890,674 Y58F probably benign Het
Olfr809 A G 10: 129,776,315 I149V probably benign Het
Rabgap1 T A 2: 37,469,489 N21K probably damaging Het
Rad9b A T 5: 122,351,578 C25S probably damaging Het
Spg7 T C 8: 123,087,363 S454P probably damaging Het
Spink2 T A 5: 77,207,025 H40L probably benign Het
Syne1 T A 10: 5,348,661 D1082V probably damaging Het
Syt2 A G 1: 134,744,021 D179G probably damaging Het
Tm7sf2 T C 19: 6,063,968 D181G probably damaging Het
Vmn1r174 A G 7: 23,754,802 I298V unknown Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Vps9d1 T C 8: 123,254,013 E25G probably damaging Het
Zfp119a T C 17: 55,866,328 R172G probably benign Het
Zfp51 A T 17: 21,465,322 Y733F possibly damaging Het
Zfp658 A C 7: 43,572,931 E210A probably benign Het
Zp2 C A 7: 120,135,764 E433* probably null Het
Other mutations in Krtcap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0560:Krtcap2 UTSW 3 89249142 critical splice donor site probably null
R1930:Krtcap2 UTSW 3 89247076 missense probably damaging 1.00
R4504:Krtcap2 UTSW 3 89246256 unclassified probably benign
R4505:Krtcap2 UTSW 3 89246256 unclassified probably benign
R4506:Krtcap2 UTSW 3 89246256 unclassified probably benign
R4507:Krtcap2 UTSW 3 89246256 unclassified probably benign
R5109:Krtcap2 UTSW 3 89246778 missense probably benign
R6363:Krtcap2 UTSW 3 89249106 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCATTTCCTCCGGACAGG -3'
(R):5'- CAGATTATTGAAGGCCTGGGTG -3'

Sequencing Primer
(F):5'- AACTTGGGTGTGCAGGGC -3'
(R):5'- TGATGTAATTAAGGAGAAACTCACGC -3'
Posted On2016-08-04