Incidental Mutation 'R5392:Spink2'
List |< first << previous [record 30 of 41] next >> last >|
ID425896
Institutional Source Beutler Lab
Gene Symbol Spink2
Ensembl Gene ENSMUSG00000053030
Gene Nameserine peptidase inhibitor, Kazal type 2
Synonymsacrosin-trypsin inhibitor, HUSI-II, 1700007F22Rik
MMRRC Submission 042964-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R5392 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location77205107-77211471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 77207025 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 40 (H40L)
Ref Sequence ENSEMBL: ENSMUSP00000067117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065216] [ENSMUST00000120429] [ENSMUST00000121825]
Predicted Effect probably benign
Transcript: ENSMUST00000065216
AA Change: H40L

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000067117
Gene: ENSMUSG00000053030
AA Change: H40L

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
KAZAL 37 86 1.95e-16 SMART
Predicted Effect unknown
Transcript: ENSMUST00000120429
AA Change: I39F
SMART Domains Protein: ENSMUSP00000112806
Gene: ENSMUSG00000053030
AA Change: I39F

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121825
AA Change: H13L

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113823
Gene: ENSMUSG00000053030
AA Change: H13L

DomainStartEndE-ValueType
KAZAL 10 59 1.95e-16 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit reduced male fertility associated with oligozoospermia, teratozoospermia, male germ cell apoptosis, and small testis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T C 2: 128,010,168 probably null Het
Acyp1 T C 12: 85,278,985 probably benign Het
Ces1b G A 8: 93,071,962 R199C probably damaging Het
Col6a3 C A 1: 90,801,295 R1308L probably benign Het
Cpa5 C T 6: 30,630,830 Q364* probably null Het
Cyth4 T A 15: 78,606,985 L88Q probably damaging Het
Dock7 A G 4: 99,008,006 V59A probably damaging Het
Drd2 A G 9: 49,395,628 N5D possibly damaging Het
Epsti1 T C 14: 77,986,744 I272T probably benign Het
Fndc3b A T 3: 27,465,787 C568* probably null Het
Frmd4a C T 2: 4,594,573 A161V probably damaging Het
Gfpt1 A G 6: 87,077,157 T465A probably damaging Het
Hecw1 C A 13: 14,245,762 Q1025H probably damaging Het
Irak4 A T 15: 94,556,684 M237L probably benign Het
Irak4 T C 15: 94,556,685 M237T probably benign Het
Kdsr T A 1: 106,753,241 I76F possibly damaging Het
Kif15 T C 9: 122,996,295 F533S probably damaging Het
Kmt5b T C 19: 3,802,127 F103L possibly damaging Het
Krtcap2 C T 3: 89,246,879 L36F probably benign Het
Mroh7 A G 4: 106,711,251 probably null Het
Mta1 T C 12: 113,133,236 V559A probably benign Het
N4bp1 A G 8: 86,860,420 probably null Het
Oas1d T C 5: 120,916,940 S192P possibly damaging Het
Olfr215 A G 6: 116,582,418 F176S probably damaging Het
Olfr353 T A 2: 36,890,674 Y58F probably benign Het
Olfr809 A G 10: 129,776,315 I149V probably benign Het
Rabgap1 T A 2: 37,469,489 N21K probably damaging Het
Rad9b A T 5: 122,351,578 C25S probably damaging Het
Spg7 T C 8: 123,087,363 S454P probably damaging Het
Syne1 T A 10: 5,348,661 D1082V probably damaging Het
Syt2 A G 1: 134,744,021 D179G probably damaging Het
Tm7sf2 T C 19: 6,063,968 D181G probably damaging Het
Vmn1r174 A G 7: 23,754,802 I298V unknown Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Vps9d1 T C 8: 123,254,013 E25G probably damaging Het
Zfp119a T C 17: 55,866,328 R172G probably benign Het
Zfp51 A T 17: 21,465,322 Y733F possibly damaging Het
Zfp658 A C 7: 43,572,931 E210A probably benign Het
Zp2 C A 7: 120,135,764 E433* probably null Het
Other mutations in Spink2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01408:Spink2 APN 5 77211327 unclassified probably benign
R1542:Spink2 UTSW 5 77206965 missense probably damaging 1.00
R1664:Spink2 UTSW 5 77207008 missense probably damaging 1.00
R4833:Spink2 UTSW 5 77205392 missense possibly damaging 0.69
R8266:Spink2 UTSW 5 77211366 missense unknown
Predicted Primers PCR Primer
(F):5'- GCTGTGAACGTGTGTGACC -3'
(R):5'- AACCATGCGGGGCTCTGA -3'

Sequencing Primer
(F):5'- TCTTGCAAAAGGACCCCAAGTTTG -3'
(R):5'- TAGAACACTGGGGACAGTG -3'
Posted On2016-08-04