Incidental Mutation 'R5392:Cpa5'
List |< first << previous [record 5 of 41] next >> last >|
ID425899
Institutional Source Beutler Lab
Gene Symbol Cpa5
Ensembl Gene ENSMUSG00000029788
Gene Namecarboxypeptidase A5
Synonyms
MMRRC Submission 042964-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R5392 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location30611010-30631745 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 30630830 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 364 (Q364*)
Ref Sequence ENSEMBL: ENSMUSP00000110792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062758] [ENSMUST00000115138] [ENSMUST00000115139] [ENSMUST00000165949]
Predicted Effect probably null
Transcript: ENSMUST00000062758
AA Change: Q364*
SMART Domains Protein: ENSMUSP00000057722
Gene: ENSMUSG00000029788
AA Change: Q364*

DomainStartEndE-ValueType
Pfam:Propep_M14 43 117 5.6e-23 PFAM
Zn_pept 139 419 4.83e-125 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115138
SMART Domains Protein: ENSMUSP00000110791
Gene: ENSMUSG00000029788

DomainStartEndE-ValueType
Pfam:Propep_M14 43 118 9.9e-26 PFAM
Zn_pept 139 395 4.62e-81 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115139
AA Change: Q364*
SMART Domains Protein: ENSMUSP00000110792
Gene: ENSMUSG00000029788
AA Change: Q364*

DomainStartEndE-ValueType
Pfam:Propep_M14 43 118 4.6e-25 PFAM
Zn_pept 139 419 4.83e-125 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165949
SMART Domains Protein: ENSMUSP00000126436
Gene: ENSMUSG00000029788

DomainStartEndE-ValueType
Pfam:Propep_M14 43 118 6.4e-26 PFAM
Zn_pept 139 309 3.6e-19 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the carboxypeptidase A family of zinc metalloproteases. The encoded preproprotein undergoes proteolytic processing that removes the N-terminal activation peptide to generate a functional enzyme. This gene is expressed in mouse testes where the encoded protein is localized to the germ cells. This gene is located in a cluster of carboxypeptidase genes on chromosome 6. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T C 2: 128,010,168 probably null Het
Acyp1 T C 12: 85,278,985 probably benign Het
Ces1b G A 8: 93,071,962 R199C probably damaging Het
Col6a3 C A 1: 90,801,295 R1308L probably benign Het
Cyth4 T A 15: 78,606,985 L88Q probably damaging Het
Dock7 A G 4: 99,008,006 V59A probably damaging Het
Drd2 A G 9: 49,395,628 N5D possibly damaging Het
Epsti1 T C 14: 77,986,744 I272T probably benign Het
Fndc3b A T 3: 27,465,787 C568* probably null Het
Frmd4a C T 2: 4,594,573 A161V probably damaging Het
Gfpt1 A G 6: 87,077,157 T465A probably damaging Het
Hecw1 C A 13: 14,245,762 Q1025H probably damaging Het
Irak4 A T 15: 94,556,684 M237L probably benign Het
Irak4 T C 15: 94,556,685 M237T probably benign Het
Kdsr T A 1: 106,753,241 I76F possibly damaging Het
Kif15 T C 9: 122,996,295 F533S probably damaging Het
Kmt5b T C 19: 3,802,127 F103L possibly damaging Het
Krtcap2 C T 3: 89,246,879 L36F probably benign Het
Mroh7 A G 4: 106,711,251 probably null Het
Mta1 T C 12: 113,133,236 V559A probably benign Het
N4bp1 A G 8: 86,860,420 probably null Het
Oas1d T C 5: 120,916,940 S192P possibly damaging Het
Olfr215 A G 6: 116,582,418 F176S probably damaging Het
Olfr353 T A 2: 36,890,674 Y58F probably benign Het
Olfr809 A G 10: 129,776,315 I149V probably benign Het
Rabgap1 T A 2: 37,469,489 N21K probably damaging Het
Rad9b A T 5: 122,351,578 C25S probably damaging Het
Spg7 T C 8: 123,087,363 S454P probably damaging Het
Spink2 T A 5: 77,207,025 H40L probably benign Het
Syne1 T A 10: 5,348,661 D1082V probably damaging Het
Syt2 A G 1: 134,744,021 D179G probably damaging Het
Tm7sf2 T C 19: 6,063,968 D181G probably damaging Het
Vmn1r174 A G 7: 23,754,802 I298V unknown Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Vps9d1 T C 8: 123,254,013 E25G probably damaging Het
Zfp119a T C 17: 55,866,328 R172G probably benign Het
Zfp51 A T 17: 21,465,322 Y733F possibly damaging Het
Zfp658 A C 7: 43,572,931 E210A probably benign Het
Zp2 C A 7: 120,135,764 E433* probably null Het
Other mutations in Cpa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01757:Cpa5 APN 6 30625927 splice site probably benign
IGL02577:Cpa5 APN 6 30626808 splice site probably benign
IGL03148:Cpa5 APN 6 30630437 missense probably damaging 1.00
IGL03341:Cpa5 APN 6 30626291 missense possibly damaging 0.57
R0836:Cpa5 UTSW 6 30623211 missense probably damaging 1.00
R1437:Cpa5 UTSW 6 30624655 missense probably damaging 1.00
R2146:Cpa5 UTSW 6 30626822 missense probably damaging 1.00
R2285:Cpa5 UTSW 6 30615064 missense probably benign 0.09
R2334:Cpa5 UTSW 6 30624606 nonsense probably null
R4081:Cpa5 UTSW 6 30631229 missense probably benign 0.02
R4454:Cpa5 UTSW 6 30626324 missense possibly damaging 0.84
R4483:Cpa5 UTSW 6 30624626 missense probably damaging 1.00
R4758:Cpa5 UTSW 6 30615160 missense possibly damaging 0.67
R4771:Cpa5 UTSW 6 30612685 nonsense probably null
R4953:Cpa5 UTSW 6 30631364 missense possibly damaging 0.84
R5053:Cpa5 UTSW 6 30623272 missense probably damaging 1.00
R5593:Cpa5 UTSW 6 30630849 missense probably benign 0.10
R5745:Cpa5 UTSW 6 30630437 missense probably damaging 1.00
R5900:Cpa5 UTSW 6 30615116 missense probably damaging 1.00
R6264:Cpa5 UTSW 6 30613985 missense probably damaging 1.00
R6268:Cpa5 UTSW 6 30615173 missense probably damaging 1.00
R6376:Cpa5 UTSW 6 30614045 missense probably benign
R6634:Cpa5 UTSW 6 30626364 missense probably damaging 1.00
R6814:Cpa5 UTSW 6 30614054 missense probably benign 0.03
R6872:Cpa5 UTSW 6 30614054 missense probably benign 0.03
R6989:Cpa5 UTSW 6 30625892 missense probably benign 0.06
R7205:Cpa5 UTSW 6 30630830 missense probably benign
R7499:Cpa5 UTSW 6 30630857 missense possibly damaging 0.81
R7864:Cpa5 UTSW 6 30631395 missense probably damaging 0.97
R8170:Cpa5 UTSW 6 30624595 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TATGAGGGTCTGGGCCAGTAATAG -3'
(R):5'- TTTCCCCTCGGAGGACTTTG -3'

Sequencing Primer
(F):5'- TAGGAAGAATCAGTAGAGTTGTTCCC -3'
(R):5'- CCTCGGAGGACTTTGTAACAG -3'
Posted On2016-08-04