Incidental Mutation 'R5392:Olfr215'
ID425901
Institutional Source Beutler Lab
Gene Symbol Olfr215
Ensembl Gene ENSMUSG00000050654
Gene Nameolfactory receptor 215
SynonymsMOR119-2, GA_x54KRFPKN04-58217732-58216800
MMRRC Submission 042964-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5392 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location116580084-116584195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116582418 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 176 (F176S)
Ref Sequence ENSEMBL: ENSMUSP00000052425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061723]
Predicted Effect probably damaging
Transcript: ENSMUST00000061723
AA Change: F176S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052425
Gene: ENSMUSG00000050654
AA Change: F176S

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5e-47 PFAM
Pfam:7TM_GPCR_Srsx 33 258 1.8e-5 PFAM
Pfam:7tm_1 39 288 2.9e-15 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T C 2: 128,010,168 probably null Het
Acyp1 T C 12: 85,278,985 probably benign Het
Ces1b G A 8: 93,071,962 R199C probably damaging Het
Col6a3 C A 1: 90,801,295 R1308L probably benign Het
Cpa5 C T 6: 30,630,830 Q364* probably null Het
Cyth4 T A 15: 78,606,985 L88Q probably damaging Het
Dock7 A G 4: 99,008,006 V59A probably damaging Het
Drd2 A G 9: 49,395,628 N5D possibly damaging Het
Epsti1 T C 14: 77,986,744 I272T probably benign Het
Fndc3b A T 3: 27,465,787 C568* probably null Het
Frmd4a C T 2: 4,594,573 A161V probably damaging Het
Gfpt1 A G 6: 87,077,157 T465A probably damaging Het
Hecw1 C A 13: 14,245,762 Q1025H probably damaging Het
Irak4 A T 15: 94,556,684 M237L probably benign Het
Irak4 T C 15: 94,556,685 M237T probably benign Het
Kdsr T A 1: 106,753,241 I76F possibly damaging Het
Kif15 T C 9: 122,996,295 F533S probably damaging Het
Kmt5b T C 19: 3,802,127 F103L possibly damaging Het
Krtcap2 C T 3: 89,246,879 L36F probably benign Het
Mroh7 A G 4: 106,711,251 probably null Het
Mta1 T C 12: 113,133,236 V559A probably benign Het
N4bp1 A G 8: 86,860,420 probably null Het
Oas1d T C 5: 120,916,940 S192P possibly damaging Het
Olfr353 T A 2: 36,890,674 Y58F probably benign Het
Olfr809 A G 10: 129,776,315 I149V probably benign Het
Rabgap1 T A 2: 37,469,489 N21K probably damaging Het
Rad9b A T 5: 122,351,578 C25S probably damaging Het
Spg7 T C 8: 123,087,363 S454P probably damaging Het
Spink2 T A 5: 77,207,025 H40L probably benign Het
Syne1 T A 10: 5,348,661 D1082V probably damaging Het
Syt2 A G 1: 134,744,021 D179G probably damaging Het
Tm7sf2 T C 19: 6,063,968 D181G probably damaging Het
Vmn1r174 A G 7: 23,754,802 I298V unknown Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Vps9d1 T C 8: 123,254,013 E25G probably damaging Het
Zfp119a T C 17: 55,866,328 R172G probably benign Het
Zfp51 A T 17: 21,465,322 Y733F possibly damaging Het
Zfp658 A C 7: 43,572,931 E210A probably benign Het
Zp2 C A 7: 120,135,764 E433* probably null Het
Other mutations in Olfr215
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01666:Olfr215 APN 6 116582335 missense possibly damaging 0.93
IGL02959:Olfr215 APN 6 116582544 missense probably damaging 1.00
IGL03053:Olfr215 APN 6 116582245 missense possibly damaging 0.50
R0078:Olfr215 UTSW 6 116582740 missense probably damaging 0.96
R0277:Olfr215 UTSW 6 116582601 missense probably damaging 0.99
R0323:Olfr215 UTSW 6 116582601 missense probably damaging 0.99
R0399:Olfr215 UTSW 6 116582781 missense probably benign 0.00
R0545:Olfr215 UTSW 6 116582656 missense probably benign 0.01
R1213:Olfr215 UTSW 6 116582866 missense probably benign 0.00
R1775:Olfr215 UTSW 6 116582964 start gained probably benign
R1789:Olfr215 UTSW 6 116582697 missense probably damaging 1.00
R4724:Olfr215 UTSW 6 116582937 missense probably damaging 1.00
R5391:Olfr215 UTSW 6 116582847 missense probably damaging 1.00
R5686:Olfr215 UTSW 6 116582929 missense probably benign 0.00
R6124:Olfr215 UTSW 6 116582485 missense probably benign 0.05
R7080:Olfr215 UTSW 6 116582353 missense probably damaging 1.00
R7355:Olfr215 UTSW 6 116582955 start gained probably benign
Z1177:Olfr215 UTSW 6 116582553 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACAGCTGCCATACATCAGAGAG -3'
(R):5'- GGTGTGTAGCTATTTGCAAGCC -3'

Sequencing Primer
(F):5'- CAGGTGGAAAAAGCTCTCTGTCTC -3'
(R):5'- GTGTAGCTATTTGCAAGCCTCTGC -3'
Posted On2016-08-04