Incidental Mutation 'R5392:Vmn2r23'
ID 425903
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Name vomeronasal 2, receptor 23
Synonyms EG435916
MMRRC Submission 042964-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R5392 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 123679780-123719198 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 123681323 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 77 (H77L)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
AlphaFold E9PXI5
Predicted Effect probably benign
Transcript: ENSMUST00000172391
AA Change: H77L

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: H77L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T C 2: 127,852,088 (GRCm39) probably null Het
Acyp1 T C 12: 85,325,759 (GRCm39) probably benign Het
Ces1b G A 8: 93,798,590 (GRCm39) R199C probably damaging Het
Col6a3 C A 1: 90,729,017 (GRCm39) R1308L probably benign Het
Cpa5 C T 6: 30,630,829 (GRCm39) Q364* probably null Het
Cyth4 T A 15: 78,491,185 (GRCm39) L88Q probably damaging Het
Dock7 A G 4: 98,896,243 (GRCm39) V59A probably damaging Het
Drd2 A G 9: 49,306,928 (GRCm39) N5D possibly damaging Het
Epsti1 T C 14: 78,224,184 (GRCm39) I272T probably benign Het
Fndc3b A T 3: 27,519,936 (GRCm39) C568* probably null Het
Frmd4a C T 2: 4,599,384 (GRCm39) A161V probably damaging Het
Gfpt1 A G 6: 87,054,139 (GRCm39) T465A probably damaging Het
Hecw1 C A 13: 14,420,347 (GRCm39) Q1025H probably damaging Het
Irak4 A T 15: 94,454,565 (GRCm39) M237L probably benign Het
Irak4 T C 15: 94,454,566 (GRCm39) M237T probably benign Het
Kdsr T A 1: 106,680,971 (GRCm39) I76F possibly damaging Het
Kif15 T C 9: 122,825,360 (GRCm39) F533S probably damaging Het
Kmt5b T C 19: 3,852,127 (GRCm39) F103L possibly damaging Het
Krtcap2 C T 3: 89,154,186 (GRCm39) L36F probably benign Het
Mroh7 A G 4: 106,568,448 (GRCm39) probably null Het
Mta1 T C 12: 113,096,856 (GRCm39) V559A probably benign Het
N4bp1 A G 8: 87,587,048 (GRCm39) probably null Het
Oas1d T C 5: 121,055,003 (GRCm39) S192P possibly damaging Het
Or1n1b T A 2: 36,780,686 (GRCm39) Y58F probably benign Het
Or6c76 A G 10: 129,612,184 (GRCm39) I149V probably benign Het
Or6d15 A G 6: 116,559,379 (GRCm39) F176S probably damaging Het
Rabgap1 T A 2: 37,359,501 (GRCm39) N21K probably damaging Het
Rad9b A T 5: 122,489,641 (GRCm39) C25S probably damaging Het
Spg7 T C 8: 123,814,102 (GRCm39) S454P probably damaging Het
Spink2 T A 5: 77,354,872 (GRCm39) H40L probably benign Het
Syne1 T A 10: 5,298,661 (GRCm39) D1082V probably damaging Het
Syt2 A G 1: 134,671,759 (GRCm39) D179G probably damaging Het
Tm7sf2 T C 19: 6,113,998 (GRCm39) D181G probably damaging Het
Vmn1r174 A G 7: 23,454,227 (GRCm39) I298V unknown Het
Vps51 T G 19: 6,121,063 (GRCm39) E283D probably benign Het
Vps9d1 T C 8: 123,980,752 (GRCm39) E25G probably damaging Het
Zfp119a T C 17: 56,173,328 (GRCm39) R172G probably benign Het
Zfp51 A T 17: 21,685,584 (GRCm39) Y733F possibly damaging Het
Zfp658 A C 7: 43,222,355 (GRCm39) E210A probably benign Het
Zp2 C A 7: 119,734,987 (GRCm39) E433* probably null Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123,706,684 (GRCm39) missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123,706,555 (GRCm39) missense probably benign
IGL01073:Vmn2r23 APN 6 123,689,759 (GRCm39) missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123,681,383 (GRCm39) missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123,681,366 (GRCm39) missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123,718,845 (GRCm39) missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123,718,819 (GRCm39) missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123,718,703 (GRCm39) missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123,718,795 (GRCm39) missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123,681,437 (GRCm39) missense probably benign
IGL02831:Vmn2r23 APN 6 123,681,344 (GRCm39) missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123,681,355 (GRCm39) missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123,718,578 (GRCm39) missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123,718,741 (GRCm39) missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123,681,333 (GRCm39) missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123,706,585 (GRCm39) missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123,706,680 (GRCm39) missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123,719,094 (GRCm39) missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123,718,963 (GRCm39) missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123,690,229 (GRCm39) nonsense probably null
R1629:Vmn2r23 UTSW 6 123,690,386 (GRCm39) missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123,706,649 (GRCm39) missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123,679,874 (GRCm39) missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123,689,969 (GRCm39) missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123,718,458 (GRCm39) missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123,681,384 (GRCm39) missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123,719,147 (GRCm39) nonsense probably null
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123,690,129 (GRCm39) missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123,718,348 (GRCm39) missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123,706,697 (GRCm39) missense probably benign
R4506:Vmn2r23 UTSW 6 123,679,884 (GRCm39) missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123,718,689 (GRCm39) missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123,718,785 (GRCm39) missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123,710,308 (GRCm39) missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R5528:Vmn2r23 UTSW 6 123,689,961 (GRCm39) missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R5761:Vmn2r23 UTSW 6 123,689,718 (GRCm39) missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123,689,901 (GRCm39) missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123,718,854 (GRCm39) missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123,681,359 (GRCm39) missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123,689,861 (GRCm39) missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123,690,384 (GRCm39) missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R6925:Vmn2r23 UTSW 6 123,681,512 (GRCm39) missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123,689,981 (GRCm39) missense probably benign
R7215:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123,718,540 (GRCm39) missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123,681,538 (GRCm39) missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123,681,500 (GRCm39) missense probably benign 0.00
R8143:Vmn2r23 UTSW 6 123,718,312 (GRCm39) missense probably damaging 0.99
R8474:Vmn2r23 UTSW 6 123,681,599 (GRCm39) missense probably benign 0.36
R8520:Vmn2r23 UTSW 6 123,718,615 (GRCm39) missense probably damaging 0.99
R8679:Vmn2r23 UTSW 6 123,690,431 (GRCm39) missense probably damaging 0.99
R8713:Vmn2r23 UTSW 6 123,679,991 (GRCm39) missense
R8966:Vmn2r23 UTSW 6 123,719,079 (GRCm39) missense possibly damaging 0.94
R9124:Vmn2r23 UTSW 6 123,719,038 (GRCm39) missense possibly damaging 0.57
R9163:Vmn2r23 UTSW 6 123,718,782 (GRCm39) missense probably damaging 1.00
R9189:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R9451:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R9495:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
R9514:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
RF018:Vmn2r23 UTSW 6 123,690,075 (GRCm39) missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123,690,120 (GRCm39) missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123,719,067 (GRCm39) missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123,706,684 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGAATGTCCTGCTTGTTTCTTGG -3'
(R):5'- TCAGGCCTACAACTGTAGTTAGG -3'

Sequencing Primer
(F):5'- CCTGCTTGTTTCTTGGATTGTTGC -3'
(R):5'- GGCCTACAACTGTAGTTAGGAATTG -3'
Posted On 2016-08-04