Incidental Mutation 'R5392:Vmn1r174'
ID425904
Institutional Source Beutler Lab
Gene Symbol Vmn1r174
Ensembl Gene ENSMUSG00000090411
Gene Namevomeronasal 1 receptor 174
SynonymsV1rd22
MMRRC Submission 042964-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5392 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location23752270-23762403 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23754802 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 298 (I298V)
Ref Sequence ENSEMBL: ENSMUSP00000154506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167551] [ENSMUST00000228331]
Predicted Effect unknown
Transcript: ENSMUST00000167551
AA Change: I298V
SMART Domains Protein: ENSMUSP00000126478
Gene: ENSMUSG00000090411
AA Change: I298V

DomainStartEndE-ValueType
Pfam:TAS2R 8 300 4e-9 PFAM
Pfam:V1R 43 300 5e-19 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000228331
AA Change: I298V
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T C 2: 128,010,168 probably null Het
Acyp1 T C 12: 85,278,985 probably benign Het
Ces1b G A 8: 93,071,962 R199C probably damaging Het
Col6a3 C A 1: 90,801,295 R1308L probably benign Het
Cpa5 C T 6: 30,630,830 Q364* probably null Het
Cyth4 T A 15: 78,606,985 L88Q probably damaging Het
Dock7 A G 4: 99,008,006 V59A probably damaging Het
Drd2 A G 9: 49,395,628 N5D possibly damaging Het
Epsti1 T C 14: 77,986,744 I272T probably benign Het
Fndc3b A T 3: 27,465,787 C568* probably null Het
Frmd4a C T 2: 4,594,573 A161V probably damaging Het
Gfpt1 A G 6: 87,077,157 T465A probably damaging Het
Hecw1 C A 13: 14,245,762 Q1025H probably damaging Het
Irak4 A T 15: 94,556,684 M237L probably benign Het
Irak4 T C 15: 94,556,685 M237T probably benign Het
Kdsr T A 1: 106,753,241 I76F possibly damaging Het
Kif15 T C 9: 122,996,295 F533S probably damaging Het
Kmt5b T C 19: 3,802,127 F103L possibly damaging Het
Krtcap2 C T 3: 89,246,879 L36F probably benign Het
Mroh7 A G 4: 106,711,251 probably null Het
Mta1 T C 12: 113,133,236 V559A probably benign Het
N4bp1 A G 8: 86,860,420 probably null Het
Oas1d T C 5: 120,916,940 S192P possibly damaging Het
Olfr215 A G 6: 116,582,418 F176S probably damaging Het
Olfr353 T A 2: 36,890,674 Y58F probably benign Het
Olfr809 A G 10: 129,776,315 I149V probably benign Het
Rabgap1 T A 2: 37,469,489 N21K probably damaging Het
Rad9b A T 5: 122,351,578 C25S probably damaging Het
Spg7 T C 8: 123,087,363 S454P probably damaging Het
Spink2 T A 5: 77,207,025 H40L probably benign Het
Syne1 T A 10: 5,348,661 D1082V probably damaging Het
Syt2 A G 1: 134,744,021 D179G probably damaging Het
Tm7sf2 T C 19: 6,063,968 D181G probably damaging Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Vps9d1 T C 8: 123,254,013 E25G probably damaging Het
Zfp119a T C 17: 55,866,328 R172G probably benign Het
Zfp51 A T 17: 21,465,322 Y733F possibly damaging Het
Zfp658 A C 7: 43,572,931 E210A probably benign Het
Zp2 C A 7: 120,135,764 E433* probably null Het
Other mutations in Vmn1r174
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Vmn1r174 APN 7 23754533 missense possibly damaging 0.77
IGL00950:Vmn1r174 APN 7 23754486 missense possibly damaging 0.96
IGL01484:Vmn1r174 APN 7 23754324 nonsense probably null
IGL02014:Vmn1r174 APN 7 23754158 missense probably damaging 1.00
IGL02190:Vmn1r174 APN 7 23754827 missense unknown
IGL03265:Vmn1r174 APN 7 23754473 nonsense probably null
IGL03335:Vmn1r174 APN 7 23754512 missense probably benign 0.41
R0529:Vmn1r174 UTSW 7 23754197 missense probably benign 0.00
R1489:Vmn1r174 UTSW 7 23754556 nonsense probably null
R1645:Vmn1r174 UTSW 7 23754352 missense possibly damaging 0.87
R1691:Vmn1r174 UTSW 7 23753912 start codon destroyed probably null 1.00
R1753:Vmn1r174 UTSW 7 23754197 missense probably benign 0.00
R1939:Vmn1r174 UTSW 7 23754107 missense probably damaging 0.99
R1988:Vmn1r174 UTSW 7 23754625 missense probably damaging 0.98
R2299:Vmn1r174 UTSW 7 23754004 missense probably benign 0.08
R4429:Vmn1r174 UTSW 7 23754140 missense probably benign 0.02
R4516:Vmn1r174 UTSW 7 23754343 missense probably benign 0.01
R4589:Vmn1r174 UTSW 7 23754779 nonsense probably null
R5175:Vmn1r174 UTSW 7 23754728 missense probably benign 0.03
R5503:Vmn1r174 UTSW 7 23754137 missense probably benign 0.03
R5568:Vmn1r174 UTSW 7 23754494 missense probably damaging 0.96
R6705:Vmn1r174 UTSW 7 23754426 missense probably benign 0.25
R8168:Vmn1r174 UTSW 7 23754671 missense probably damaging 0.99
R8190:Vmn1r174 UTSW 7 23754143 missense probably damaging 1.00
X0011:Vmn1r174 UTSW 7 23754481 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACTTCAACCAGAGGCCAGAG -3'
(R):5'- AACTTATGTGATCTACCTCCCG -3'

Sequencing Primer
(F):5'- GCAAACACAATTCTCATGCTGATG -3'
(R):5'- CAGGGTCTCTGGATGACAATC -3'
Posted On2016-08-04