Incidental Mutation 'R5392:Zfp658'
List |< first << previous [record 40 of 41] next >> last >|
ID425905
Institutional Source Beutler Lab
Gene Symbol Zfp658
Ensembl Gene ENSMUSG00000056592
Gene Namezinc finger protein 658
Synonyms
MMRRC Submission 042964-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5392 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location43562256-43575461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 43572931 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 210 (E210A)
Ref Sequence ENSEMBL: ENSMUSP00000103606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005597] [ENSMUST00000107972]
Predicted Effect probably benign
Transcript: ENSMUST00000005597
AA Change: E210A

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000005597
Gene: ENSMUSG00000056592
AA Change: E210A

DomainStartEndE-ValueType
KRAB 23 83 3.7e-27 SMART
ZnF_C2H2 276 295 8.84e1 SMART
ZnF_C2H2 301 323 5.81e-2 SMART
ZnF_C2H2 328 350 1.5e-4 SMART
ZnF_C2H2 356 378 1.84e-4 SMART
ZnF_C2H2 384 406 3.16e-3 SMART
ZnF_C2H2 412 434 1.45e-2 SMART
ZnF_C2H2 440 462 4.87e-4 SMART
ZnF_C2H2 468 490 4.87e-4 SMART
ZnF_C2H2 496 518 6.88e-4 SMART
ZnF_C2H2 524 546 1.69e-3 SMART
ZnF_C2H2 552 574 9.73e-4 SMART
ZnF_C2H2 580 602 1.82e-3 SMART
ZnF_C2H2 608 630 3.16e-3 SMART
ZnF_C2H2 636 658 8.94e-3 SMART
ZnF_C2H2 664 686 3.74e-5 SMART
ZnF_C2H2 692 714 2.99e-4 SMART
ZnF_C2H2 720 742 5.21e-4 SMART
ZnF_C2H2 748 770 2.79e-4 SMART
ZnF_C2H2 776 798 1.58e-3 SMART
ZnF_C2H2 804 826 3.44e-4 SMART
ZnF_C2H2 832 854 5.59e-4 SMART
ZnF_C2H2 860 882 5.81e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107972
AA Change: E210A

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000103606
Gene: ENSMUSG00000056592
AA Change: E210A

DomainStartEndE-ValueType
KRAB 23 83 3.7e-27 SMART
ZnF_C2H2 276 295 8.84e1 SMART
ZnF_C2H2 301 323 5.81e-2 SMART
ZnF_C2H2 328 350 1.5e-4 SMART
ZnF_C2H2 356 378 1.84e-4 SMART
ZnF_C2H2 384 406 3.16e-3 SMART
ZnF_C2H2 412 434 1.45e-2 SMART
ZnF_C2H2 440 462 4.87e-4 SMART
ZnF_C2H2 468 490 4.87e-4 SMART
ZnF_C2H2 496 518 6.88e-4 SMART
ZnF_C2H2 524 546 1.69e-3 SMART
ZnF_C2H2 552 574 9.73e-4 SMART
ZnF_C2H2 580 602 1.82e-3 SMART
ZnF_C2H2 608 630 3.16e-3 SMART
ZnF_C2H2 636 658 8.94e-3 SMART
ZnF_C2H2 664 686 3.74e-5 SMART
ZnF_C2H2 692 714 2.99e-4 SMART
ZnF_C2H2 720 742 5.21e-4 SMART
ZnF_C2H2 748 770 2.79e-4 SMART
ZnF_C2H2 776 798 1.58e-3 SMART
ZnF_C2H2 804 826 3.44e-4 SMART
ZnF_C2H2 832 854 5.59e-4 SMART
ZnF_C2H2 860 882 5.81e-2 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T C 2: 128,010,168 probably null Het
Acyp1 T C 12: 85,278,985 probably benign Het
Ces1b G A 8: 93,071,962 R199C probably damaging Het
Col6a3 C A 1: 90,801,295 R1308L probably benign Het
Cpa5 C T 6: 30,630,830 Q364* probably null Het
Cyth4 T A 15: 78,606,985 L88Q probably damaging Het
Dock7 A G 4: 99,008,006 V59A probably damaging Het
Drd2 A G 9: 49,395,628 N5D possibly damaging Het
Epsti1 T C 14: 77,986,744 I272T probably benign Het
Fndc3b A T 3: 27,465,787 C568* probably null Het
Frmd4a C T 2: 4,594,573 A161V probably damaging Het
Gfpt1 A G 6: 87,077,157 T465A probably damaging Het
Hecw1 C A 13: 14,245,762 Q1025H probably damaging Het
Irak4 A T 15: 94,556,684 M237L probably benign Het
Irak4 T C 15: 94,556,685 M237T probably benign Het
Kdsr T A 1: 106,753,241 I76F possibly damaging Het
Kif15 T C 9: 122,996,295 F533S probably damaging Het
Kmt5b T C 19: 3,802,127 F103L possibly damaging Het
Krtcap2 C T 3: 89,246,879 L36F probably benign Het
Mroh7 A G 4: 106,711,251 probably null Het
Mta1 T C 12: 113,133,236 V559A probably benign Het
N4bp1 A G 8: 86,860,420 probably null Het
Oas1d T C 5: 120,916,940 S192P possibly damaging Het
Olfr215 A G 6: 116,582,418 F176S probably damaging Het
Olfr353 T A 2: 36,890,674 Y58F probably benign Het
Olfr809 A G 10: 129,776,315 I149V probably benign Het
Rabgap1 T A 2: 37,469,489 N21K probably damaging Het
Rad9b A T 5: 122,351,578 C25S probably damaging Het
Spg7 T C 8: 123,087,363 S454P probably damaging Het
Spink2 T A 5: 77,207,025 H40L probably benign Het
Syne1 T A 10: 5,348,661 D1082V probably damaging Het
Syt2 A G 1: 134,744,021 D179G probably damaging Het
Tm7sf2 T C 19: 6,063,968 D181G probably damaging Het
Vmn1r174 A G 7: 23,754,802 I298V unknown Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Vps9d1 T C 8: 123,254,013 E25G probably damaging Het
Zfp119a T C 17: 55,866,328 R172G probably benign Het
Zfp51 A T 17: 21,465,322 Y733F possibly damaging Het
Zp2 C A 7: 120,135,764 E433* probably null Het
Other mutations in Zfp658
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Zfp658 APN 7 43567356 missense probably benign 0.03
IGL00475:Zfp658 APN 7 43574076 missense possibly damaging 0.68
IGL01972:Zfp658 APN 7 43572710 nonsense probably null
IGL03223:Zfp658 APN 7 43567311 missense possibly damaging 0.85
R0135:Zfp658 UTSW 7 43573595 nonsense probably null
R1863:Zfp658 UTSW 7 43573899 missense possibly damaging 0.78
R1962:Zfp658 UTSW 7 43573821 missense possibly damaging 0.93
R2698:Zfp658 UTSW 7 43573545 missense possibly damaging 0.53
R3781:Zfp658 UTSW 7 43573846 missense probably benign
R4791:Zfp658 UTSW 7 43574466 missense possibly damaging 0.93
R6092:Zfp658 UTSW 7 43574527 missense possibly damaging 0.73
R6594:Zfp658 UTSW 7 43567277 missense possibly damaging 0.86
R7003:Zfp658 UTSW 7 43574748 missense possibly damaging 0.85
R7008:Zfp658 UTSW 7 43573912 missense possibly damaging 0.95
R7077:Zfp658 UTSW 7 43573989 missense probably benign 0.32
R7689:Zfp658 UTSW 7 43574678 missense probably benign 0.00
R7793:Zfp658 UTSW 7 43574684 missense possibly damaging 0.74
R7939:Zfp658 UTSW 7 43574877 missense possibly damaging 0.73
Z1176:Zfp658 UTSW 7 43573217 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- ACTGTGGCAAGATCCTGACC -3'
(R):5'- AATGAGCTTCTTTCTCTGTCAGTTG -3'

Sequencing Primer
(F):5'- CTGACCCTGCACAAAGAGATGG -3'
(R):5'- GTTTATGGGTGGGAACTTTTCTGCAC -3'
Posted On2016-08-04