Incidental Mutation 'R5392:N4bp1'
List |< first << previous [record 22 of 41] next >> last >|
ID425908
Institutional Source Beutler Lab
Gene Symbol N4bp1
Ensembl Gene ENSMUSG00000031652
Gene NameNEDD4 binding protein 1
Synonyms
MMRRC Submission 042964-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5392 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location86808160-86885258 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 86860420 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034074]
Predicted Effect probably null
Transcript: ENSMUST00000034074
SMART Domains Protein: ENSMUSP00000034074
Gene: ENSMUSG00000031652

DomainStartEndE-ValueType
low complexity region 29 43 N/A INTRINSIC
low complexity region 375 390 N/A INTRINSIC
low complexity region 548 571 N/A INTRINSIC
Pfam:RNase_Zc3h12a 614 767 4.7e-59 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T C 2: 128,010,168 probably null Het
Acyp1 T C 12: 85,278,985 probably benign Het
Ces1b G A 8: 93,071,962 R199C probably damaging Het
Col6a3 C A 1: 90,801,295 R1308L probably benign Het
Cpa5 C T 6: 30,630,830 Q364* probably null Het
Cyth4 T A 15: 78,606,985 L88Q probably damaging Het
Dock7 A G 4: 99,008,006 V59A probably damaging Het
Drd2 A G 9: 49,395,628 N5D possibly damaging Het
Epsti1 T C 14: 77,986,744 I272T probably benign Het
Fndc3b A T 3: 27,465,787 C568* probably null Het
Frmd4a C T 2: 4,594,573 A161V probably damaging Het
Gfpt1 A G 6: 87,077,157 T465A probably damaging Het
Hecw1 C A 13: 14,245,762 Q1025H probably damaging Het
Irak4 A T 15: 94,556,684 M237L probably benign Het
Irak4 T C 15: 94,556,685 M237T probably benign Het
Kdsr T A 1: 106,753,241 I76F possibly damaging Het
Kif15 T C 9: 122,996,295 F533S probably damaging Het
Kmt5b T C 19: 3,802,127 F103L possibly damaging Het
Krtcap2 C T 3: 89,246,879 L36F probably benign Het
Mroh7 A G 4: 106,711,251 probably null Het
Mta1 T C 12: 113,133,236 V559A probably benign Het
Oas1d T C 5: 120,916,940 S192P possibly damaging Het
Olfr215 A G 6: 116,582,418 F176S probably damaging Het
Olfr353 T A 2: 36,890,674 Y58F probably benign Het
Olfr809 A G 10: 129,776,315 I149V probably benign Het
Rabgap1 T A 2: 37,469,489 N21K probably damaging Het
Rad9b A T 5: 122,351,578 C25S probably damaging Het
Spg7 T C 8: 123,087,363 S454P probably damaging Het
Spink2 T A 5: 77,207,025 H40L probably benign Het
Syne1 T A 10: 5,348,661 D1082V probably damaging Het
Syt2 A G 1: 134,744,021 D179G probably damaging Het
Tm7sf2 T C 19: 6,063,968 D181G probably damaging Het
Vmn1r174 A G 7: 23,754,802 I298V unknown Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Vps9d1 T C 8: 123,254,013 E25G probably damaging Het
Zfp119a T C 17: 55,866,328 R172G probably benign Het
Zfp51 A T 17: 21,465,322 Y733F possibly damaging Het
Zfp658 A C 7: 43,572,931 E210A probably benign Het
Zp2 C A 7: 120,135,764 E433* probably null Het
Other mutations in N4bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00653:N4bp1 APN 8 86861726 missense probably benign 0.01
IGL00659:N4bp1 APN 8 86861802 missense probably damaging 1.00
IGL01484:N4bp1 APN 8 86844772 missense probably damaging 0.99
IGL01788:N4bp1 APN 8 86860996 missense probably benign 0.06
IGL01989:N4bp1 APN 8 86848487 missense probably damaging 1.00
IGL02619:N4bp1 APN 8 86860901 missense probably benign 0.01
IGL03290:N4bp1 APN 8 86848533 missense probably benign 0.31
Acorn UTSW 8 86861906 nonsense probably null
oak UTSW 8 86861796 nonsense probably null
Squirrel UTSW 8 86851709 missense probably damaging 1.00
Stash UTSW 8 86860424 critical splice donor site probably null
walnut UTSW 8 86846912 missense probably damaging 1.00
winter UTSW 8 86861683 missense probably benign
R0760:N4bp1 UTSW 8 86846912 missense probably damaging 1.00
R1202:N4bp1 UTSW 8 86844887 missense probably benign 0.02
R1653:N4bp1 UTSW 8 86844948 missense probably benign 0.10
R1878:N4bp1 UTSW 8 86861541 missense probably damaging 0.98
R2325:N4bp1 UTSW 8 86848460 missense probably damaging 1.00
R2442:N4bp1 UTSW 8 86862040 missense probably damaging 1.00
R2867:N4bp1 UTSW 8 86861405 missense probably benign 0.02
R2867:N4bp1 UTSW 8 86861405 missense probably benign 0.02
R2926:N4bp1 UTSW 8 86861796 nonsense probably null
R3625:N4bp1 UTSW 8 86851709 missense probably damaging 1.00
R3689:N4bp1 UTSW 8 86860556 missense probably damaging 1.00
R3863:N4bp1 UTSW 8 86860427 missense probably benign 0.13
R4872:N4bp1 UTSW 8 86861048 missense probably benign 0.01
R4902:N4bp1 UTSW 8 86861683 missense probably benign
R4965:N4bp1 UTSW 8 86851686 missense possibly damaging 0.69
R5070:N4bp1 UTSW 8 86860537 missense probably damaging 0.98
R5719:N4bp1 UTSW 8 86851684 missense probably damaging 1.00
R6280:N4bp1 UTSW 8 86853166 missense possibly damaging 0.68
R6292:N4bp1 UTSW 8 86853239 missense probably damaging 0.99
R6350:N4bp1 UTSW 8 86861968 missense probably damaging 0.99
R6543:N4bp1 UTSW 8 86861906 nonsense probably null
R6965:N4bp1 UTSW 8 86844833 missense probably damaging 1.00
R7120:N4bp1 UTSW 8 86860867 missense probably benign 0.01
R7172:N4bp1 UTSW 8 86860424 critical splice donor site probably null
R7791:N4bp1 UTSW 8 86853203 missense probably damaging 0.99
R8084:N4bp1 UTSW 8 86861008 missense probably benign 0.28
R8220:N4bp1 UTSW 8 86844687 makesense probably null
X0067:N4bp1 UTSW 8 86861920 missense probably damaging 1.00
Z1177:N4bp1 UTSW 8 86853159 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGTCTCTTACCCACAGGAATAGG -3'
(R):5'- AGGCTCGATTGGGAGGGTC -3'

Sequencing Primer
(F):5'- TCCCGAGCAGCCAAGATAGTTTG -3'
(R):5'- CGATTGGGAGGGTCCTCTGAC -3'
Posted On2016-08-04