Incidental Mutation 'R5392:Spg7'
ID425910
Institutional Source Beutler Lab
Gene Symbol Spg7
Ensembl Gene ENSMUSG00000000738
Gene NameSPG7, paraplegin matrix AAA peptidase subunit
SynonymsCmar, paraplegin
MMRRC Submission 042964-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R5392 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location123062942-123097760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123087363 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 454 (S454P)
Ref Sequence ENSEMBL: ENSMUSP00000115039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108868] [ENSMUST00000125975] [ENSMUST00000127664] [ENSMUST00000135991] [ENSMUST00000149248] [ENSMUST00000153285]
Predicted Effect probably damaging
Transcript: ENSMUST00000108868
AA Change: S454P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104496
Gene: ENSMUSG00000000738
AA Change: S454P

DomainStartEndE-ValueType
low complexity region 5 60 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
Pfam:FtsH_ext 142 242 5.2e-12 PFAM
transmembrane domain 250 272 N/A INTRINSIC
AAA 341 481 1.96e-19 SMART
Pfam:Peptidase_M41 541 746 1.8e-74 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000125975
AA Change: S349P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120361
Gene: ENSMUSG00000000738
AA Change: S349P

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
Pfam:FtsH_ext 37 137 8.5e-12 PFAM
transmembrane domain 145 167 N/A INTRINSIC
AAA 236 376 1.96e-19 SMART
Pfam:Peptidase_M41 436 641 9.8e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect unknown
Transcript: ENSMUST00000128234
AA Change: S22P
SMART Domains Protein: ENSMUSP00000120793
Gene: ENSMUSG00000000738
AA Change: S22P

DomainStartEndE-ValueType
Pfam:AAA 1 48 5.8e-10 PFAM
Pfam:Peptidase_M41 110 222 9.7e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130787
Predicted Effect probably benign
Transcript: ENSMUST00000135991
SMART Domains Protein: ENSMUSP00000118066
Gene: ENSMUSG00000000738

DomainStartEndE-ValueType
Pfam:Peptidase_M41 1 81 2.5e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142150
Predicted Effect probably damaging
Transcript: ENSMUST00000149248
AA Change: S454P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119552
Gene: ENSMUSG00000000738
AA Change: S454P

DomainStartEndE-ValueType
low complexity region 5 60 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
Pfam:FtsH_ext 142 242 3.9e-11 PFAM
transmembrane domain 250 272 N/A INTRINSIC
AAA 341 481 1.96e-19 SMART
Pfam:Peptidase_M41 541 746 7e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152972
Predicted Effect probably damaging
Transcript: ENSMUST00000153285
AA Change: S454P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115039
Gene: ENSMUSG00000000738
AA Change: S454P

DomainStartEndE-ValueType
low complexity region 5 60 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
Pfam:FtsH_ext 142 242 3.8e-11 PFAM
transmembrane domain 250 272 N/A INTRINSIC
AAA 341 481 1.96e-19 SMART
Pfam:Peptidase_M41 515 709 2.5e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153492
SMART Domains Protein: ENSMUSP00000133602
Gene: ENSMUSG00000000738

DomainStartEndE-ValueType
Pfam:FtsH_ext 1 102 1.3e-12 PFAM
transmembrane domain 110 132 N/A INTRINSIC
PDB:2QZ4|A 165 192 1e-8 PDB
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial metalloprotease protein that is a member of the AAA family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, organelle biogenesis, protein folding, and proteolysis. Mutations in this gene cause autosomal recessive spastic paraplegia 7. Two transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice exhibit impaired motor skills, putativley associated with axonal degeneration in the central and peripheral nervous systems. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T C 2: 128,010,168 probably null Het
Acyp1 T C 12: 85,278,985 probably benign Het
Ces1b G A 8: 93,071,962 R199C probably damaging Het
Col6a3 C A 1: 90,801,295 R1308L probably benign Het
Cpa5 C T 6: 30,630,830 Q364* probably null Het
Cyth4 T A 15: 78,606,985 L88Q probably damaging Het
Dock7 A G 4: 99,008,006 V59A probably damaging Het
Drd2 A G 9: 49,395,628 N5D possibly damaging Het
Epsti1 T C 14: 77,986,744 I272T probably benign Het
Fndc3b A T 3: 27,465,787 C568* probably null Het
Frmd4a C T 2: 4,594,573 A161V probably damaging Het
Gfpt1 A G 6: 87,077,157 T465A probably damaging Het
Hecw1 C A 13: 14,245,762 Q1025H probably damaging Het
Irak4 A T 15: 94,556,684 M237L probably benign Het
Irak4 T C 15: 94,556,685 M237T probably benign Het
Kdsr T A 1: 106,753,241 I76F possibly damaging Het
Kif15 T C 9: 122,996,295 F533S probably damaging Het
Kmt5b T C 19: 3,802,127 F103L possibly damaging Het
Krtcap2 C T 3: 89,246,879 L36F probably benign Het
Mroh7 A G 4: 106,711,251 probably null Het
Mta1 T C 12: 113,133,236 V559A probably benign Het
N4bp1 A G 8: 86,860,420 probably null Het
Oas1d T C 5: 120,916,940 S192P possibly damaging Het
Olfr215 A G 6: 116,582,418 F176S probably damaging Het
Olfr353 T A 2: 36,890,674 Y58F probably benign Het
Olfr809 A G 10: 129,776,315 I149V probably benign Het
Rabgap1 T A 2: 37,469,489 N21K probably damaging Het
Rad9b A T 5: 122,351,578 C25S probably damaging Het
Spink2 T A 5: 77,207,025 H40L probably benign Het
Syne1 T A 10: 5,348,661 D1082V probably damaging Het
Syt2 A G 1: 134,744,021 D179G probably damaging Het
Tm7sf2 T C 19: 6,063,968 D181G probably damaging Het
Vmn1r174 A G 7: 23,754,802 I298V unknown Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Vps9d1 T C 8: 123,254,013 E25G probably damaging Het
Zfp119a T C 17: 55,866,328 R172G probably benign Het
Zfp51 A T 17: 21,465,322 Y733F possibly damaging Het
Zfp658 A C 7: 43,572,931 E210A probably benign Het
Zp2 C A 7: 120,135,764 E433* probably null Het
Other mutations in Spg7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Spg7 APN 8 123076930 missense probably damaging 1.00
IGL01868:Spg7 APN 8 123090236 critical splice donor site probably null
IGL02551:Spg7 APN 8 123076978 missense probably damaging 1.00
IGL02744:Spg7 APN 8 123093661 missense probably damaging 1.00
IGL03161:Spg7 APN 8 123087331 missense probably damaging 1.00
IGL03165:Spg7 APN 8 123080812 critical splice donor site probably null
R0729:Spg7 UTSW 8 123070417 missense probably damaging 0.96
R1580:Spg7 UTSW 8 123090238 unclassified probably benign
R1696:Spg7 UTSW 8 123090225 missense probably benign 0.05
R1909:Spg7 UTSW 8 123080741 missense probably benign 0.01
R3751:Spg7 UTSW 8 123087373 missense probably damaging 1.00
R3753:Spg7 UTSW 8 123087373 missense probably damaging 1.00
R3921:Spg7 UTSW 8 123087373 missense probably damaging 1.00
R3976:Spg7 UTSW 8 123079448 missense probably damaging 1.00
R4908:Spg7 UTSW 8 123080655 missense probably damaging 1.00
R4952:Spg7 UTSW 8 123090171 missense probably damaging 1.00
R5637:Spg7 UTSW 8 123094575 missense possibly damaging 0.82
R5684:Spg7 UTSW 8 123073884 missense probably damaging 1.00
R5810:Spg7 UTSW 8 123094569 missense possibly damaging 0.94
R6452:Spg7 UTSW 8 123079423 missense possibly damaging 0.54
R6453:Spg7 UTSW 8 123079423 missense possibly damaging 0.54
R6454:Spg7 UTSW 8 123079423 missense possibly damaging 0.54
R6750:Spg7 UTSW 8 123073911 missense probably damaging 1.00
R7090:Spg7 UTSW 8 123091752 critical splice donor site probably null
R7213:Spg7 UTSW 8 123090232 missense probably damaging 1.00
R7705:Spg7 UTSW 8 123073878 missense possibly damaging 0.63
R7811:Spg7 UTSW 8 123097425 missense possibly damaging 0.89
R7863:Spg7 UTSW 8 123089049 critical splice donor site probably null
R8375:Spg7 UTSW 8 123073829 missense probably damaging 0.99
Z1177:Spg7 UTSW 8 123090223 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGCCGTTGTGAAGGTGTC -3'
(R):5'- CTGTAACAGCAGAGCTTCCTG -3'

Sequencing Primer
(F):5'- CTCATCGGTCTGTCCAGATGGAG -3'
(R):5'- AGCAGAGCTTCCTGTCCCAAG -3'
Posted On2016-08-04