Incidental Mutation 'R5392:Zfp119a'
ID425927
Institutional Source Beutler Lab
Gene Symbol Zfp119a
Ensembl Gene ENSMUSG00000057835
Gene Namezinc finger protein 119a
SynonymsMzf13, Zfp119
MMRRC Submission 042964-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5392 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location55864892-55878930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55866328 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 172 (R172G)
Ref Sequence ENSEMBL: ENSMUSP00000078587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079642]
Predicted Effect probably benign
Transcript: ENSMUST00000079642
AA Change: R172G

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000078587
Gene: ENSMUSG00000057835
AA Change: R172G

DomainStartEndE-ValueType
KRAB 4 66 6.16e-15 SMART
ZnF_C2H2 155 177 1.57e2 SMART
ZnF_C2H2 261 283 2.14e2 SMART
ZnF_C2H2 289 311 6.78e-3 SMART
ZnF_C2H2 317 339 1.98e-4 SMART
ZnF_C2H2 345 367 4.17e-3 SMART
ZnF_C2H2 373 395 3.39e-3 SMART
ZnF_C2H2 401 423 1.64e-1 SMART
ZnF_C2H2 429 451 5.5e-3 SMART
ZnF_C2H2 457 479 1.51e0 SMART
ZnF_C2H2 485 507 6.32e-3 SMART
ZnF_C2H2 513 535 1.69e-3 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T C 2: 128,010,168 probably null Het
Acyp1 T C 12: 85,278,985 probably benign Het
Ces1b G A 8: 93,071,962 R199C probably damaging Het
Col6a3 C A 1: 90,801,295 R1308L probably benign Het
Cpa5 C T 6: 30,630,830 Q364* probably null Het
Cyth4 T A 15: 78,606,985 L88Q probably damaging Het
Dock7 A G 4: 99,008,006 V59A probably damaging Het
Drd2 A G 9: 49,395,628 N5D possibly damaging Het
Epsti1 T C 14: 77,986,744 I272T probably benign Het
Fndc3b A T 3: 27,465,787 C568* probably null Het
Frmd4a C T 2: 4,594,573 A161V probably damaging Het
Gfpt1 A G 6: 87,077,157 T465A probably damaging Het
Hecw1 C A 13: 14,245,762 Q1025H probably damaging Het
Irak4 A T 15: 94,556,684 M237L probably benign Het
Irak4 T C 15: 94,556,685 M237T probably benign Het
Kdsr T A 1: 106,753,241 I76F possibly damaging Het
Kif15 T C 9: 122,996,295 F533S probably damaging Het
Kmt5b T C 19: 3,802,127 F103L possibly damaging Het
Krtcap2 C T 3: 89,246,879 L36F probably benign Het
Mroh7 A G 4: 106,711,251 probably null Het
Mta1 T C 12: 113,133,236 V559A probably benign Het
N4bp1 A G 8: 86,860,420 probably null Het
Oas1d T C 5: 120,916,940 S192P possibly damaging Het
Olfr215 A G 6: 116,582,418 F176S probably damaging Het
Olfr353 T A 2: 36,890,674 Y58F probably benign Het
Olfr809 A G 10: 129,776,315 I149V probably benign Het
Rabgap1 T A 2: 37,469,489 N21K probably damaging Het
Rad9b A T 5: 122,351,578 C25S probably damaging Het
Spg7 T C 8: 123,087,363 S454P probably damaging Het
Spink2 T A 5: 77,207,025 H40L probably benign Het
Syne1 T A 10: 5,348,661 D1082V probably damaging Het
Syt2 A G 1: 134,744,021 D179G probably damaging Het
Tm7sf2 T C 19: 6,063,968 D181G probably damaging Het
Vmn1r174 A G 7: 23,754,802 I298V unknown Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Vps9d1 T C 8: 123,254,013 E25G probably damaging Het
Zfp51 A T 17: 21,465,322 Y733F possibly damaging Het
Zfp658 A C 7: 43,572,931 E210A probably benign Het
Zp2 C A 7: 120,135,764 E433* probably null Het
Other mutations in Zfp119a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Zfp119a APN 17 55865792 nonsense probably null
R0421:Zfp119a UTSW 17 55865248 nonsense probably null
R1385:Zfp119a UTSW 17 55865826 missense probably damaging 1.00
R1600:Zfp119a UTSW 17 55868355 missense possibly damaging 0.93
R2310:Zfp119a UTSW 17 55865440 missense probably benign 0.00
R2924:Zfp119a UTSW 17 55868343 missense possibly damaging 0.96
R3910:Zfp119a UTSW 17 55866520 missense probably benign
R4594:Zfp119a UTSW 17 55866325 missense probably benign
R5217:Zfp119a UTSW 17 55865425 nonsense probably null
R5321:Zfp119a UTSW 17 55865595 missense probably damaging 1.00
R5678:Zfp119a UTSW 17 55868336 missense probably benign 0.03
R7033:Zfp119a UTSW 17 55866009 missense probably benign 0.04
R7355:Zfp119a UTSW 17 55866287 nonsense probably null
R7489:Zfp119a UTSW 17 55866158 missense probably damaging 1.00
R8130:Zfp119a UTSW 17 55865971 missense probably damaging 1.00
Z1176:Zfp119a UTSW 17 55866011 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TCTTTCATGCTTGTGAAAATGACTTT -3'
(R):5'- TTTCCAGCCTCAGTGGGAATA -3'

Sequencing Primer
(F):5'- TGGGATACGAAAAAGCTTTACCC -3'
(R):5'- GTGGGAATACATCAAAATACTGACC -3'
Posted On2016-08-04