Incidental Mutation 'R5392:Kmt5b'
ID425928
Institutional Source Beutler Lab
Gene Symbol Kmt5b
Ensembl Gene ENSMUSG00000045098
Gene Namelysine methyltransferase 5B
SynonymsC630029K18Rik, Suv420h1, Suv4-20h1
MMRRC Submission 042964-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5392 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location3767421-3818303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3802127 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 103 (F103L)
Ref Sequence ENSEMBL: ENSMUSP00000115984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005518] [ENSMUST00000052699] [ENSMUST00000113968] [ENSMUST00000113970] [ENSMUST00000113972] [ENSMUST00000113973] [ENSMUST00000113974] [ENSMUST00000113977] [ENSMUST00000152935] [ENSMUST00000176926] [ENSMUST00000176262]
Predicted Effect probably benign
Transcript: ENSMUST00000005518
AA Change: F145L

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000005518
Gene: ENSMUSG00000045098
AA Change: F145L

DomainStartEndE-ValueType
Blast:SET 58 126 4e-37 BLAST
SET 199 315 3.46e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052699
AA Change: F145L

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000060162
Gene: ENSMUSG00000045098
AA Change: F145L

DomainStartEndE-ValueType
Blast:SET 58 126 1e-36 BLAST
SET 199 315 3.46e-17 SMART
low complexity region 368 379 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113968
AA Change: F145L

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109601
Gene: ENSMUSG00000045098
AA Change: F145L

DomainStartEndE-ValueType
Blast:SET 58 126 4e-37 BLAST
SET 199 315 3.46e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113970
AA Change: F145L

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109603
Gene: ENSMUSG00000045098
AA Change: F145L

DomainStartEndE-ValueType
Blast:SET 58 126 1e-36 BLAST
SET 199 315 3.46e-17 SMART
low complexity region 368 379 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113972
AA Change: F145L

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109605
Gene: ENSMUSG00000045098
AA Change: F145L

DomainStartEndE-ValueType
Blast:SET 58 126 1e-34 BLAST
SET 199 315 3.46e-17 SMART
low complexity region 368 379 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
low complexity region 536 547 N/A INTRINSIC
low complexity region 814 846 N/A INTRINSIC
low complexity region 863 874 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113973
AA Change: F145L

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109606
Gene: ENSMUSG00000045098
AA Change: F145L

DomainStartEndE-ValueType
Blast:SET 58 126 1e-34 BLAST
SET 199 315 3.46e-17 SMART
low complexity region 368 379 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
low complexity region 536 547 N/A INTRINSIC
low complexity region 814 846 N/A INTRINSIC
low complexity region 863 874 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113974
AA Change: F122L

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109607
Gene: ENSMUSG00000045098
AA Change: F122L

DomainStartEndE-ValueType
Blast:SET 58 107 6e-21 BLAST
SET 176 292 3.46e-17 SMART
low complexity region 345 356 N/A INTRINSIC
low complexity region 374 385 N/A INTRINSIC
low complexity region 416 429 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
low complexity region 791 823 N/A INTRINSIC
low complexity region 840 851 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113977
AA Change: F122L

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109610
Gene: ENSMUSG00000045098
AA Change: F122L

DomainStartEndE-ValueType
Blast:SET 58 107 6e-21 BLAST
SET 176 292 3.46e-17 SMART
low complexity region 345 356 N/A INTRINSIC
low complexity region 374 385 N/A INTRINSIC
low complexity region 416 429 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
low complexity region 791 823 N/A INTRINSIC
low complexity region 840 851 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135586
Predicted Effect possibly damaging
Transcript: ENSMUST00000152935
AA Change: F103L

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115984
Gene: ENSMUSG00000045098
AA Change: F103L

DomainStartEndE-ValueType
Blast:SET 16 84 9e-39 BLAST
PDB:3S8P|B 22 212 1e-139 PDB
Blast:SET 157 212 4e-32 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176125
Predicted Effect probably benign
Transcript: ENSMUST00000176926
AA Change: F145L

PolyPhen 2 Score 0.445 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135756
Gene: ENSMUSG00000045098
AA Change: F145L

DomainStartEndE-ValueType
Blast:SET 58 126 3e-36 BLAST
SET 199 315 3.46e-17 SMART
low complexity region 368 379 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176262
AA Change: F122L

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000135563
Gene: ENSMUSG00000045098
AA Change: F122L

DomainStartEndE-ValueType
Blast:SET 58 107 6e-21 BLAST
SET 176 292 3.46e-17 SMART
low complexity region 345 356 N/A INTRINSIC
low complexity region 374 385 N/A INTRINSIC
low complexity region 416 429 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
low complexity region 791 823 N/A INTRINSIC
low complexity region 840 851 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a SET domain. SET domains appear to be protein-protein interaction domains that mediate interactions with a family of proteins that display similarity with dual-specificity phosphatases (dsPTPases). The function of this gene has not been determined. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are born at sub-Mendelian ratios, are smaller than control littermates, and die within a few hours of birth, probably due to alveolar defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T C 2: 128,010,168 probably null Het
Acyp1 T C 12: 85,278,985 probably benign Het
Ces1b G A 8: 93,071,962 R199C probably damaging Het
Col6a3 C A 1: 90,801,295 R1308L probably benign Het
Cpa5 C T 6: 30,630,830 Q364* probably null Het
Cyth4 T A 15: 78,606,985 L88Q probably damaging Het
Dock7 A G 4: 99,008,006 V59A probably damaging Het
Drd2 A G 9: 49,395,628 N5D possibly damaging Het
Epsti1 T C 14: 77,986,744 I272T probably benign Het
Fndc3b A T 3: 27,465,787 C568* probably null Het
Frmd4a C T 2: 4,594,573 A161V probably damaging Het
Gfpt1 A G 6: 87,077,157 T465A probably damaging Het
Hecw1 C A 13: 14,245,762 Q1025H probably damaging Het
Irak4 A T 15: 94,556,684 M237L probably benign Het
Irak4 T C 15: 94,556,685 M237T probably benign Het
Kdsr T A 1: 106,753,241 I76F possibly damaging Het
Kif15 T C 9: 122,996,295 F533S probably damaging Het
Krtcap2 C T 3: 89,246,879 L36F probably benign Het
Mroh7 A G 4: 106,711,251 probably null Het
Mta1 T C 12: 113,133,236 V559A probably benign Het
N4bp1 A G 8: 86,860,420 probably null Het
Oas1d T C 5: 120,916,940 S192P possibly damaging Het
Olfr215 A G 6: 116,582,418 F176S probably damaging Het
Olfr353 T A 2: 36,890,674 Y58F probably benign Het
Olfr809 A G 10: 129,776,315 I149V probably benign Het
Rabgap1 T A 2: 37,469,489 N21K probably damaging Het
Rad9b A T 5: 122,351,578 C25S probably damaging Het
Spg7 T C 8: 123,087,363 S454P probably damaging Het
Spink2 T A 5: 77,207,025 H40L probably benign Het
Syne1 T A 10: 5,348,661 D1082V probably damaging Het
Syt2 A G 1: 134,744,021 D179G probably damaging Het
Tm7sf2 T C 19: 6,063,968 D181G probably damaging Het
Vmn1r174 A G 7: 23,754,802 I298V unknown Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Vps9d1 T C 8: 123,254,013 E25G probably damaging Het
Zfp119a T C 17: 55,866,328 R172G probably benign Het
Zfp51 A T 17: 21,465,322 Y733F possibly damaging Het
Zfp658 A C 7: 43,572,931 E210A probably benign Het
Zp2 C A 7: 120,135,764 E433* probably null Het
Other mutations in Kmt5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01521:Kmt5b APN 19 3786618 missense possibly damaging 0.86
IGL02005:Kmt5b APN 19 3786538 missense possibly damaging 0.50
IGL02058:Kmt5b APN 19 3793181 missense probably damaging 1.00
IGL02069:Kmt5b APN 19 3807335 missense probably damaging 1.00
IGL02395:Kmt5b APN 19 3814887 missense probably benign 0.01
IGL02701:Kmt5b APN 19 3796681 missense probably benign 0.08
P0047:Kmt5b UTSW 19 3793223 splice site probably benign
R0127:Kmt5b UTSW 19 3786465 start codon destroyed probably null 0.99
R1574:Kmt5b UTSW 19 3786633 splice site probably null
R1574:Kmt5b UTSW 19 3786633 splice site probably null
R1797:Kmt5b UTSW 19 3814833 missense probably benign 0.03
R2178:Kmt5b UTSW 19 3815372 missense possibly damaging 0.68
R2418:Kmt5b UTSW 19 3807266 missense probably benign 0.00
R4290:Kmt5b UTSW 19 3802193 missense possibly damaging 0.51
R4789:Kmt5b UTSW 19 3815330 missense probably benign 0.00
R4939:Kmt5b UTSW 19 3815245 missense possibly damaging 0.88
R5133:Kmt5b UTSW 19 3802240 missense probably damaging 1.00
R5568:Kmt5b UTSW 19 3786538 missense probably benign 0.00
R6029:Kmt5b UTSW 19 3802104 missense probably damaging 0.99
R6184:Kmt5b UTSW 19 3804499 missense probably damaging 1.00
R6649:Kmt5b UTSW 19 3807295 missense probably damaging 0.96
R7043:Kmt5b UTSW 19 3815220 missense possibly damaging 0.47
R7131:Kmt5b UTSW 19 3815412 missense probably benign 0.00
R7203:Kmt5b UTSW 19 3814147 missense probably damaging 1.00
R7287:Kmt5b UTSW 19 3804501 missense possibly damaging 0.79
R7468:Kmt5b UTSW 19 3802799 nonsense probably null
R7850:Kmt5b UTSW 19 3815043 missense probably damaging 1.00
R8103:Kmt5b UTSW 19 3815381 missense probably benign 0.00
R8334:Kmt5b UTSW 19 3814795 missense probably benign 0.00
R8336:Kmt5b UTSW 19 3815531 missense probably damaging 1.00
Z1176:Kmt5b UTSW 19 3793118 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGACTCAGGTTCAGTTCTAGTAC -3'
(R):5'- CAGCCAGTTGCAATGTATCTGG -3'

Sequencing Primer
(F):5'- TGGTGCACATATACGCATGC -3'
(R):5'- CCAGTTGCAATGTATCTGGACATAGG -3'
Posted On2016-08-04