Incidental Mutation 'R5392:Tm7sf2'
List |< first << previous [record 33 of 41] next >> last >|
ID425929
Institutional Source Beutler Lab
Gene Symbol Tm7sf2
Ensembl Gene ENSMUSG00000024799
Gene Nametransmembrane 7 superfamily member 2
Synonyms3110041O18Rik, ANG1
MMRRC Submission 042964-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5392 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location6062821-6077197 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6063968 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 181 (D181G)
Ref Sequence ENSEMBL: ENSMUSP00000125586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025711] [ENSMUST00000025713] [ENSMUST00000043074] [ENSMUST00000113543] [ENSMUST00000159084] [ENSMUST00000159832] [ENSMUST00000160028] [ENSMUST00000161090] [ENSMUST00000161528] [ENSMUST00000162575] [ENSMUST00000161718] [ENSMUST00000178310] [ENSMUST00000162810] [ENSMUST00000179142] [ENSMUST00000162726]
Predicted Effect probably benign
Transcript: ENSMUST00000025711
SMART Domains Protein: ENSMUSP00000025711
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:COG2 56 191 2.6e-10 PFAM
Pfam:DUF2450 62 250 2.3e-14 PFAM
Pfam:Vps51 63 149 1.1e-26 PFAM
Pfam:Dor1 75 246 1.8e-19 PFAM
Pfam:Zw10 83 291 2.2e-8 PFAM
Pfam:Sec5 101 275 6.5e-24 PFAM
low complexity region 377 391 N/A INTRINSIC
low complexity region 523 532 N/A INTRINSIC
low complexity region 743 758 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000025713
AA Change: D249G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025713
Gene: ENSMUSG00000024799
AA Change: D249G

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 418 1.6e-141 PFAM
Pfam:DUF1295 250 409 9.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043074
SMART Domains Protein: ENSMUSP00000042835
Gene: ENSMUSG00000038274

DomainStartEndE-ValueType
UBQ 1 70 2.55e-20 SMART
Pfam:Ribosomal_S30 75 133 9.4e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113543
AA Change: D249G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109171
Gene: ENSMUSG00000024799
AA Change: D249G

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 373 9.9e-112 PFAM
Pfam:DUF1295 249 396 2.6e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159084
AA Change: D249G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124868
Gene: ENSMUSG00000024799
AA Change: D249G

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 300 6.4e-75 PFAM
Pfam:ERG4_ERG24 292 391 2.2e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159475
Predicted Effect probably benign
Transcript: ENSMUST00000159832
SMART Domains Protein: ENSMUSP00000123994
Gene: ENSMUSG00000024797

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:COG2 56 191 2e-10 PFAM
Pfam:DUF2450 62 250 1.9e-14 PFAM
Pfam:Vps51 63 149 8.3e-27 PFAM
Pfam:Dor1 75 246 1.8e-19 PFAM
Pfam:Sec5 101 275 1.6e-19 PFAM
low complexity region 276 292 N/A INTRINSIC
low complexity region 377 391 N/A INTRINSIC
low complexity region 523 532 N/A INTRINSIC
low complexity region 743 758 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159869
Predicted Effect probably benign
Transcript: ENSMUST00000160028
SMART Domains Protein: ENSMUSP00000124847
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160417
Predicted Effect probably benign
Transcript: ENSMUST00000161090
SMART Domains Protein: ENSMUSP00000125543
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161222
Predicted Effect probably benign
Transcript: ENSMUST00000161528
SMART Domains Protein: ENSMUSP00000123989
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 109 5.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162575
AA Change: D181G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125586
Gene: ENSMUSG00000024799
AA Change: D181G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:ERG4_ERG24 51 229 5.5e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161718
AA Change: D49G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124283
Gene: ENSMUSG00000024799
AA Change: D49G

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 1 197 5.7e-86 PFAM
Pfam:DUF1295 46 185 1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162721
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162549
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161634
Predicted Effect probably benign
Transcript: ENSMUST00000178310
SMART Domains Protein: ENSMUSP00000136803
Gene: ENSMUSG00000038274

DomainStartEndE-ValueType
UBQ 1 70 2.55e-20 SMART
Pfam:Ribosomal_S30 75 133 9.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162810
SMART Domains Protein: ENSMUSP00000124825
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 9 124 6.9e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179142
SMART Domains Protein: ENSMUSP00000136358
Gene: ENSMUSG00000038274

DomainStartEndE-ValueType
UBQ 1 70 2.55e-20 SMART
Pfam:Ribosomal_S30 75 132 6.7e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162726
SMART Domains Protein: ENSMUSP00000134031
Gene: ENSMUSG00000075227

DomainStartEndE-ValueType
Pfam:zf-HIT 3 36 2e-15 PFAM
low complexity region 54 97 N/A INTRINSIC
low complexity region 120 140 N/A INTRINSIC
low complexity region 167 205 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit normal plasma cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T C 2: 128,010,168 probably null Het
Acyp1 T C 12: 85,278,985 probably benign Het
Ces1b G A 8: 93,071,962 R199C probably damaging Het
Col6a3 C A 1: 90,801,295 R1308L probably benign Het
Cpa5 C T 6: 30,630,830 Q364* probably null Het
Cyth4 T A 15: 78,606,985 L88Q probably damaging Het
Dock7 A G 4: 99,008,006 V59A probably damaging Het
Drd2 A G 9: 49,395,628 N5D possibly damaging Het
Epsti1 T C 14: 77,986,744 I272T probably benign Het
Fndc3b A T 3: 27,465,787 C568* probably null Het
Frmd4a C T 2: 4,594,573 A161V probably damaging Het
Gfpt1 A G 6: 87,077,157 T465A probably damaging Het
Hecw1 C A 13: 14,245,762 Q1025H probably damaging Het
Irak4 A T 15: 94,556,684 M237L probably benign Het
Irak4 T C 15: 94,556,685 M237T probably benign Het
Kdsr T A 1: 106,753,241 I76F possibly damaging Het
Kif15 T C 9: 122,996,295 F533S probably damaging Het
Kmt5b T C 19: 3,802,127 F103L possibly damaging Het
Krtcap2 C T 3: 89,246,879 L36F probably benign Het
Mroh7 A G 4: 106,711,251 probably null Het
Mta1 T C 12: 113,133,236 V559A probably benign Het
N4bp1 A G 8: 86,860,420 probably null Het
Oas1d T C 5: 120,916,940 S192P possibly damaging Het
Olfr215 A G 6: 116,582,418 F176S probably damaging Het
Olfr353 T A 2: 36,890,674 Y58F probably benign Het
Olfr809 A G 10: 129,776,315 I149V probably benign Het
Rabgap1 T A 2: 37,469,489 N21K probably damaging Het
Rad9b A T 5: 122,351,578 C25S probably damaging Het
Spg7 T C 8: 123,087,363 S454P probably damaging Het
Spink2 T A 5: 77,207,025 H40L probably benign Het
Syne1 T A 10: 5,348,661 D1082V probably damaging Het
Syt2 A G 1: 134,744,021 D179G probably damaging Het
Vmn1r174 A G 7: 23,754,802 I298V unknown Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Vps9d1 T C 8: 123,254,013 E25G probably damaging Het
Zfp119a T C 17: 55,866,328 R172G probably benign Het
Zfp51 A T 17: 21,465,322 Y733F possibly damaging Het
Zfp658 A C 7: 43,572,931 E210A probably benign Het
Zp2 C A 7: 120,135,764 E433* probably null Het
Other mutations in Tm7sf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02292:Tm7sf2 APN 19 6063568 missense probably damaging 1.00
IGL03299:Tm7sf2 APN 19 6062928 missense probably benign 0.03
PIT4791001:Tm7sf2 UTSW 19 6063605 missense probably benign 0.00
R0033:Tm7sf2 UTSW 19 6066422 splice site probably benign
R0033:Tm7sf2 UTSW 19 6066422 splice site probably benign
R1607:Tm7sf2 UTSW 19 6063019 splice site probably null
R3415:Tm7sf2 UTSW 19 6063599 missense probably damaging 1.00
R5835:Tm7sf2 UTSW 19 6063884 missense probably damaging 1.00
R5886:Tm7sf2 UTSW 19 6066542 unclassified probably benign
R6065:Tm7sf2 UTSW 19 6063386 missense possibly damaging 0.65
R6300:Tm7sf2 UTSW 19 6067200 missense probably damaging 1.00
R6915:Tm7sf2 UTSW 19 6068312 missense probably damaging 0.99
R7037:Tm7sf2 UTSW 19 6064077 critical splice donor site probably null
R7073:Tm7sf2 UTSW 19 6066497 critical splice donor site probably null
R7328:Tm7sf2 UTSW 19 6064126 missense possibly damaging 0.63
R7373:Tm7sf2 UTSW 19 6066646 missense probably benign 0.39
R7612:Tm7sf2 UTSW 19 6070608 missense probably benign 0.08
R7779:Tm7sf2 UTSW 19 6062917 missense possibly damaging 0.95
R7903:Tm7sf2 UTSW 19 6071335 missense probably damaging 1.00
R7904:Tm7sf2 UTSW 19 6068912 missense probably damaging 0.96
R8082:Tm7sf2 UTSW 19 6066321 missense probably damaging 1.00
R8155:Tm7sf2 UTSW 19 6064095 missense probably damaging 1.00
R8428:Tm7sf2 UTSW 19 6063044 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTAGAGAAGCGTCAGAGCCTAG -3'
(R):5'- CTATGTGGCTGGTCAATGGC -3'

Sequencing Primer
(F):5'- TCAGAGCCTAGGCCCTACC -3'
(R):5'- GCTGGTCAATGGCTTCCAG -3'
Posted On2016-08-04