Mutagenetix > Incidental Mutation

Incidental Mutation 'R5393:Insrr'

425943

Institutional Source

Beutler Lab

Gene Symbol

Insrr

Ensembl Gene

ENSMUSG00000005640

Gene Name

insulin receptor-related receptor

Synonyms

MMRRC Submission

042965-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.299) question?

Stock #

R5393 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87796951-87816101 bp(+) (GRCm38)

Type of Mutation

splice site (13524 bp from exon)

DNA Base Change (assembly)

T to C at 87810700 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000088503 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029711] [ENSMUST00000029714] [ENSMUST00000090981] [ENSMUST00000107582]

AlphaFold

Q9WTL4

Predicted Effect

probably damaging
Transcript: ENSMUST00000029711
AA Change: V876A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000029711
Gene: ENSMUSG00000005640
AA Change: V876A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Recep_L_domain	47	159	1.8e-25	PFAM
FU	225	268	9.54e-11	SMART
Pfam:Recep_L_domain	346	460	3.8e-28	PFAM
FN3	483	586	9.19e-1	SMART
FN3	605	798	6.45e-5	SMART
FN3	816	899	6.35e-4	SMART
TyrKc	979	1246	4.61e-128	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000029714

SMART Domains

Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
low complexity region	67	78	N/A	INTRINSIC
EGF	102	130	3.82e-2	SMART
EGF_like	132	173	2.92e1	SMART
EGF_like	146	185	1.92e0	SMART
EGF_like	189	246	1.99e0	SMART
EGF	217	258	1.04e1	SMART
EGF_Lam	274	313	1.21e-4	SMART
EGF	312	344	4.03e-1	SMART
EGF_Lam	361	402	1.33e-1	SMART
EGF	401	433	1.18e-2	SMART
EGF_like	449	488	1.72e0	SMART
EGF	487	519	6.92e0	SMART
EGF_Lam	535	574	2.08e-3	SMART
EGF	573	605	5.49e-3	SMART
EGF_Lam	620	660	1.58e-3	SMART
EGF	659	691	3.1e-2	SMART
EGF	702	734	2.53e1	SMART
transmembrane domain	754	776	N/A	INTRINSIC
low complexity region	809	822	N/A	INTRINSIC
low complexity region	829	835	N/A	INTRINSIC
low complexity region	954	971	N/A	INTRINSIC
low complexity region	993	1002	N/A	INTRINSIC
low complexity region	1019	1031	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000090981

SMART Domains

Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
low complexity region	67	78	N/A	INTRINSIC
EGF	102	130	3.82e-2	SMART
EGF_like	132	173	2.92e1	SMART
EGF_like	146	185	1.92e0	SMART
EGF_like	189	246	1.99e0	SMART
EGF	217	258	1.04e1	SMART
EGF_Lam	274	313	1.21e-4	SMART
EGF	312	344	4.03e-1	SMART
EGF_Lam	361	402	1.33e-1	SMART
EGF	401	433	1.18e-2	SMART
EGF_like	449	488	1.72e0	SMART
EGF	487	519	6.92e0	SMART
EGF_Lam	535	574	2.08e-3	SMART
EGF	573	605	5.49e-3	SMART
EGF_Lam	620	660	1.58e-3	SMART
EGF	659	691	3.1e-2	SMART
EGF	702	734	2.53e1	SMART
transmembrane domain	754	776	N/A	INTRINSIC
low complexity region	809	822	N/A	INTRINSIC
low complexity region	829	835	N/A	INTRINSIC
low complexity region	954	971	N/A	INTRINSIC
low complexity region	993	1002	N/A	INTRINSIC
low complexity region	1019	1031	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107582
AA Change: V876A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000103208
Gene: ENSMUSG00000005640
AA Change: V876A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Recep_L_domain	47	159	7.7e-25	PFAM
FU	225	268	9.54e-11	SMART
Pfam:Recep_L_domain	346	460	1.6e-28	PFAM
FN3	483	586	9.19e-1	SMART
FN3	605	798	6.45e-5	SMART
FN3	816	899	6.35e-4	SMART
TyrKc	979	1246	4.61e-128	SMART

Meta Mutation Damage Score

0.1668

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

99% (72/73)

MGI Phenotype

PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no anomalies in pancreatic islet morphology, beta-cell mass or pancreatic secretory function. This mutation in combination with Insr mutant mice does not affect the diabetes predisposition of Insr mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110025L11Rik	A	T	16: 89,063,765	Y60*	probably null	Het
2810403A07Rik	T	A	3: 88,696,606	H243Q	probably benign	Het
Abca6	T	A	11: 110,244,295	E221D	probably benign	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Adi1	A	G	12: 28,675,275	D8G	probably benign	Het
Adnp	T	C	2: 168,182,949	K809E	possibly damaging	Het
Aldh18a1	T	C	19: 40,585,567	H4R	probably benign	Het
Atp6v0a1	T	C	11: 101,038,807	S485P	possibly damaging	Het
C1galt1	T	C	6: 7,864,143		probably null	Het
Cacna2d4	A	T	6: 119,239,054	N94I	probably benign	Het
Catsperg1	T	C	7: 29,185,499	N899S	probably damaging	Het
Coro2a	A	G	4: 46,542,255	S373P	probably damaging	Het
Cpsf6	G	C	10: 117,362,016		probably benign	Het
Csmd3	A	T	15: 47,633,703	N3099K	probably damaging	Het
Ctla2b	T	A	13: 60,896,132	E74D	probably damaging	Het
Dnah2	T	A	11: 69,500,857	T671S	probably benign	Het
Drd5	T	A	5: 38,320,905	S414T	probably benign	Het
Dyrk2	C	T	10: 118,859,848	D502N	probably damaging	Het
Ecel1	A	T	1: 87,152,876	L376Q	possibly damaging	Het
Efcab8	G	A	2: 153,780,983	R24Q	unknown	Het
Eloc	A	C	1: 16,647,968		probably benign	Het
Ep300	A	G	15: 81,631,618		probably benign	Het
Fam89b	T	C	19: 5,728,705	D152G	probably damaging	Het
Gm15455	G	A	1: 33,836,846		noncoding transcript	Het
Greb1l	A	G	18: 10,458,312	T30A	probably benign	Het
Hdac10	T	C	15: 89,126,684	Y238C	probably damaging	Het
Ick	A	G	9: 78,160,715	T463A	probably benign	Het
Ighv2-5	T	C	12: 113,685,882	T12A	possibly damaging	Het
Irf9	T	C	14: 55,606,457		probably benign	Het
Itpr2	A	T	6: 146,376,155	C280*	probably null	Het
Kcnk18	T	C	19: 59,219,839	C36R	probably damaging	Het
Klhl14	G	T	18: 21,651,994	N125K	probably benign	Het
Lce1i	T	C	3: 92,777,735	S45G	unknown	Het
Lrmda	A	C	14: 22,027,306	D37A	probably damaging	Het
Marco	A	C	1: 120,485,854	D280E	probably damaging	Het
Miox	C	T	15: 89,336,247	Q180*	probably null	Het
Npdc1	A	T	2: 25,408,670	M265L	probably damaging	Het
Nudcd3	T	C	11: 6,113,274	K205R	probably damaging	Het
Olfr319	T	A	11: 58,702,500	H266Q	probably damaging	Het
Olfr325	C	G	11: 58,580,999	L52V	possibly damaging	Het
Pcdhga5	C	T	18: 37,696,667	R723C	probably benign	Het
Pdlim5	T	A	3: 142,259,186	E295D	probably damaging	Het
Poli	C	A	18: 70,517,428	E314*	probably null	Het
Ptpro	A	G	6: 137,380,224	N238D	probably benign	Het
R3hdm1	A	G	1: 128,231,347	I920V	probably benign	Het
Ralgapa2	C	T	2: 146,345,455	V1338M	probably damaging	Het
Saa3	T	C	7: 46,712,661	Y53C	probably damaging	Het
Sept14	T	A	5: 129,683,586	E398D	probably benign	Het
Six3	T	C	17: 85,623,842	S309P	possibly damaging	Het
Slc7a14	A	G	3: 31,257,770	S34P	probably damaging	Het
Smarca2	C	A	19: 26,640,429	Q287K	probably benign	Het
Stard9	C	T	2: 120,702,906	L522F	possibly damaging	Het
Sycp1	T	C	3: 102,841,047		probably null	Het
Tbc1d8	A	T	1: 39,426,088	V73E	probably damaging	Het
Tldc1	T	C	8: 119,772,418	I112V	probably benign	Het
Tmem120a	T	C	5: 135,736,250		probably null	Het
Tsc2	T	C	17: 24,600,396	E1251G	possibly damaging	Het
Vps51	T	G	19: 6,071,033	E283D	probably benign	Het
Wnt5b	A	C	6: 119,440,433	L157R	probably damaging	Het
Zbtb24	T	A	10: 41,464,582	V536E	probably damaging	Het
Zfp593	G	A	4: 134,245,304	A67V	probably benign	Het
Zfp995	A	T	17: 21,880,492	F254I	probably benign	Het

Other mutations in Insrr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00718:Insrr	APN	3	87813674	critical splice donor site	probably null
IGL00801:Insrr	APN	3	87813808	missense	probably damaging	1.00
IGL01628:Insrr	APN	3	87800792	nonsense	probably null
IGL01755:Insrr	APN	3	87814186	missense	probably damaging	1.00
IGL02100:Insrr	APN	3	87811620	missense	probably damaging	1.00
IGL02261:Insrr	APN	3	87800722	missense	probably damaging	1.00
IGL02366:Insrr	APN	3	87809909	missense	possibly damaging	0.91
IGL02387:Insrr	APN	3	87813127	missense	probably damaging	1.00
IGL02478:Insrr	APN	3	87809412	missense	probably benign	0.14
IGL02550:Insrr	APN	3	87804498	missense	probably damaging	1.00
IGL02555:Insrr	APN	3	87813817	missense	probably damaging	0.99
IGL02673:Insrr	APN	3	87813061	missense	possibly damaging	0.95
IGL02724:Insrr	APN	3	87809572	missense	probably benign	0.31
IGL02798:Insrr	APN	3	87810517	missense	probably damaging	1.00
IGL02969:Insrr	APN	3	87814191	nonsense	probably null
IGL03073:Insrr	APN	3	87809938	splice site	probably benign
IGL03178:Insrr	APN	3	87802541	splice site	probably null
IGL03389:Insrr	APN	3	87808731	missense	probably damaging	1.00
IGL03399:Insrr	APN	3	87809331	missense	probably null	0.99
IGL02799:Insrr	UTSW	3	87813581	missense	probably damaging	1.00
R0011:Insrr	UTSW	3	87809616	missense	possibly damaging	0.86
R0053:Insrr	UTSW	3	87800452	missense	probably damaging	1.00
R0053:Insrr	UTSW	3	87800452	missense	probably damaging	1.00
R0357:Insrr	UTSW	3	87808646	splice site	probably null
R0501:Insrr	UTSW	3	87810684	missense	probably benign	0.12
R0504:Insrr	UTSW	3	87813156	missense	possibly damaging	0.69
R0522:Insrr	UTSW	3	87800872	missense	probably damaging	1.00
R0555:Insrr	UTSW	3	87814437	splice site	probably benign
R0558:Insrr	UTSW	3	87810981	missense	possibly damaging	0.77
R0599:Insrr	UTSW	3	87813133	missense	probably damaging	0.97
R1312:Insrr	UTSW	3	87800490	missense	probably damaging	1.00
R1694:Insrr	UTSW	3	87804062	missense	probably benign
R1785:Insrr	UTSW	3	87810572	splice site	probably null
R1786:Insrr	UTSW	3	87810572	splice site	probably null
R1892:Insrr	UTSW	3	87813877	missense	probably damaging	1.00
R1950:Insrr	UTSW	3	87814513	missense	probably damaging	1.00
R2080:Insrr	UTSW	3	87814291	missense	possibly damaging	0.79
R2094:Insrr	UTSW	3	87803181	missense	probably damaging	1.00
R2130:Insrr	UTSW	3	87810572	splice site	probably null
R2131:Insrr	UTSW	3	87810572	splice site	probably null
R2133:Insrr	UTSW	3	87810572	splice site	probably null
R2220:Insrr	UTSW	3	87809418	missense	probably damaging	1.00
R2259:Insrr	UTSW	3	87800452	missense	probably damaging	1.00
R2404:Insrr	UTSW	3	87802667	missense	possibly damaging	0.71
R4027:Insrr	UTSW	3	87809599	missense	probably benign
R4042:Insrr	UTSW	3	87813827	missense	probably damaging	1.00
R4510:Insrr	UTSW	3	87808671	missense	possibly damaging	0.67
R4511:Insrr	UTSW	3	87808671	missense	possibly damaging	0.67
R4571:Insrr	UTSW	3	87800887	missense	probably benign
R4870:Insrr	UTSW	3	87811604	missense	probably damaging	1.00
R5057:Insrr	UTSW	3	87815265	missense	probably benign	0.00
R5685:Insrr	UTSW	3	87800496	splice site	probably null
R6039:Insrr	UTSW	3	87809301	missense	possibly damaging	0.56
R6039:Insrr	UTSW	3	87809301	missense	possibly damaging	0.56
R6047:Insrr	UTSW	3	87804176	missense	probably damaging	1.00
R6276:Insrr	UTSW	3	87800519	nonsense	probably null
R6298:Insrr	UTSW	3	87812965	missense	probably damaging	1.00
R6726:Insrr	UTSW	3	87813566	missense	probably damaging	1.00
R6727:Insrr	UTSW	3	87813566	missense	probably damaging	1.00
R6728:Insrr	UTSW	3	87813566	missense	probably damaging	1.00
R6796:Insrr	UTSW	3	87813566	missense	probably damaging	1.00
R7041:Insrr	UTSW	3	87815244	missense	probably damaging	1.00
R7169:Insrr	UTSW	3	87808594	missense	probably benign	0.15
R7270:Insrr	UTSW	3	87803133	missense	probably damaging	1.00
R7340:Insrr	UTSW	3	87814316	critical splice donor site	probably null
R7398:Insrr	UTSW	3	87808732	missense	probably damaging	1.00
R7473:Insrr	UTSW	3	87804531	splice site	probably null
R7815:Insrr	UTSW	3	87808695	missense	probably damaging	0.98
R8159:Insrr	UTSW	3	87800428	missense	probably damaging	1.00
R8289:Insrr	UTSW	3	87814194	missense	probably damaging	1.00
R8309:Insrr	UTSW	3	87810442	missense	probably benign	0.00
R8312:Insrr	UTSW	3	87800484	missense	possibly damaging	0.93
R8445:Insrr	UTSW	3	87813584	missense	probably damaging	1.00
R8917:Insrr	UTSW	3	87810969	missense	probably benign	0.00
R8960:Insrr	UTSW	3	87813079	missense	probably damaging	1.00
R8989:Insrr	UTSW	3	87815357	missense	probably damaging	0.96
R9015:Insrr	UTSW	3	87813603	missense	probably damaging	1.00
R9202:Insrr	UTSW	3	87813120	missense	probably damaging	1.00
R9251:Insrr	UTSW	3	87810084	missense	probably benign	0.08
R9327:Insrr	UTSW	3	87814297	missense	probably damaging	1.00
R9646:Insrr	UTSW	3	87814498	missense	probably damaging	1.00
RF022:Insrr	UTSW	3	87804485	missense	possibly damaging	0.51
Z1177:Insrr	UTSW	3	87800827	missense	possibly damaging	0.91
Z1192:Insrr	UTSW	3	87802579	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAGAGCAGTGTCACCTTGC -3'
(R):5'- AACGCTGGAGCATGGTCATG -3'

Sequencing Primer
(F):5'- CCAATGGGCTCATTCTCAAGTATG -3'
(R):5'- ATGGTCATGGGCAGGGC -3'

Posted On

2016-08-04