Incidental Mutation 'R5393:Sept14'
ID425953
Institutional Source Beutler Lab
Gene Symbol Sept14
Ensembl Gene ENSMUSG00000034219
Gene Nameseptin 14
Synonyms1700016K13Rik
MMRRC Submission 042965-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R5393 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location129683391-129708512 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129683586 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 398 (E398D)
Ref Sequence ENSEMBL: ENSMUSP00000138729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042266] [ENSMUST00000182386]
Predicted Effect probably benign
Transcript: ENSMUST00000042266
AA Change: E399D

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000044272
Gene: ENSMUSG00000034219
AA Change: E399D

DomainStartEndE-ValueType
Pfam:Septin 48 319 1.5e-97 PFAM
low complexity region 381 401 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182381
Predicted Effect probably benign
Transcript: ENSMUST00000182386
AA Change: E398D

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000138729
Gene: ENSMUSG00000034219
AA Change: E398D

DomainStartEndE-ValueType
Pfam:Septin 48 318 3.8e-99 PFAM
low complexity region 380 400 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SEPT14 is a member of the highly conserved septin family of GTP-binding cytoskeletal proteins implicated in membrane transport, apoptosis, cell polarity, cell cycle regulation, cytokinesis, and other cellular functions (Peterson et al., 2007 [PubMed 17922164]).[supplied by OMIM, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik A T 16: 89,063,765 Y60* probably null Het
2810403A07Rik T A 3: 88,696,606 H243Q probably benign Het
Abca6 T A 11: 110,244,295 E221D probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adi1 A G 12: 28,675,275 D8G probably benign Het
Adnp T C 2: 168,182,949 K809E possibly damaging Het
Aldh18a1 T C 19: 40,585,567 H4R probably benign Het
Atp6v0a1 T C 11: 101,038,807 S485P possibly damaging Het
C1galt1 T C 6: 7,864,143 probably null Het
Cacna2d4 A T 6: 119,239,054 N94I probably benign Het
Catsperg1 T C 7: 29,185,499 N899S probably damaging Het
Coro2a A G 4: 46,542,255 S373P probably damaging Het
Cpsf6 G C 10: 117,362,016 probably benign Het
Csmd3 A T 15: 47,633,703 N3099K probably damaging Het
Ctla2b T A 13: 60,896,132 E74D probably damaging Het
Dnah2 T A 11: 69,500,857 T671S probably benign Het
Drd5 T A 5: 38,320,905 S414T probably benign Het
Dyrk2 C T 10: 118,859,848 D502N probably damaging Het
Ecel1 A T 1: 87,152,876 L376Q possibly damaging Het
Efcab8 G A 2: 153,780,983 R24Q unknown Het
Eloc A C 1: 16,647,968 probably benign Het
Ep300 A G 15: 81,631,618 probably benign Het
Fam89b T C 19: 5,728,705 D152G probably damaging Het
Gm15455 G A 1: 33,836,846 noncoding transcript Het
Greb1l A G 18: 10,458,312 T30A probably benign Het
Hdac10 T C 15: 89,126,684 Y238C probably damaging Het
Ick A G 9: 78,160,715 T463A probably benign Het
Ighv2-5 T C 12: 113,685,882 T12A possibly damaging Het
Insrr T C 3: 87,810,700 probably null Het
Irf9 T C 14: 55,606,457 probably benign Het
Itpr2 A T 6: 146,376,155 C280* probably null Het
Kcnk18 T C 19: 59,219,839 C36R probably damaging Het
Klhl14 G T 18: 21,651,994 N125K probably benign Het
Lce1i T C 3: 92,777,735 S45G unknown Het
Lrmda A C 14: 22,027,306 D37A probably damaging Het
Marco A C 1: 120,485,854 D280E probably damaging Het
Miox C T 15: 89,336,247 Q180* probably null Het
Npdc1 A T 2: 25,408,670 M265L probably damaging Het
Nudcd3 T C 11: 6,113,274 K205R probably damaging Het
Olfr319 T A 11: 58,702,500 H266Q probably damaging Het
Olfr325 C G 11: 58,580,999 L52V possibly damaging Het
Pcdhga5 C T 18: 37,696,667 R723C probably benign Het
Pdlim5 T A 3: 142,259,186 E295D probably damaging Het
Poli C A 18: 70,517,428 E314* probably null Het
Ptpro A G 6: 137,380,224 N238D probably benign Het
R3hdm1 A G 1: 128,231,347 I920V probably benign Het
Ralgapa2 C T 2: 146,345,455 V1338M probably damaging Het
Saa3 T C 7: 46,712,661 Y53C probably damaging Het
Six3 T C 17: 85,623,842 S309P possibly damaging Het
Slc7a14 A G 3: 31,257,770 S34P probably damaging Het
Smarca2 C A 19: 26,640,429 Q287K probably benign Het
Stard9 C T 2: 120,702,906 L522F possibly damaging Het
Sycp1 T C 3: 102,841,047 probably null Het
Tbc1d8 A T 1: 39,426,088 V73E probably damaging Het
Tldc1 T C 8: 119,772,418 I112V probably benign Het
Tmem120a T C 5: 135,736,250 probably null Het
Tsc2 T C 17: 24,600,396 E1251G possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnt5b A C 6: 119,440,433 L157R probably damaging Het
Zbtb24 T A 10: 41,464,582 V536E probably damaging Het
Zfp593 G A 4: 134,245,304 A67V probably benign Het
Zfp995 A T 17: 21,880,492 F254I probably benign Het
Other mutations in Sept14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Sept14 APN 5 129683651 missense probably benign 0.26
IGL01622:Sept14 APN 5 129685955 missense probably damaging 0.99
IGL01623:Sept14 APN 5 129685955 missense probably damaging 0.99
IGL03088:Sept14 APN 5 129697733 splice site probably benign
R0658:Sept14 UTSW 5 129697908 missense probably benign 0.30
R1485:Sept14 UTSW 5 129693054 missense probably damaging 1.00
R1649:Sept14 UTSW 5 129697755 missense probably benign 0.19
R2518:Sept14 UTSW 5 129699035 missense probably benign
R2973:Sept14 UTSW 5 129699022 missense probably benign 0.42
R4679:Sept14 UTSW 5 129693026 missense possibly damaging 0.89
R4906:Sept14 UTSW 5 129692966 missense probably benign 0.39
R5004:Sept14 UTSW 5 129692976 missense possibly damaging 0.88
R5303:Sept14 UTSW 5 129689648 missense possibly damaging 0.79
R5329:Sept14 UTSW 5 129685914 critical splice donor site probably null
R5542:Sept14 UTSW 5 129697862 missense probably damaging 1.00
R5725:Sept14 UTSW 5 129689566 missense probably damaging 1.00
R6750:Sept14 UTSW 5 129696117 missense probably damaging 1.00
R6796:Sept14 UTSW 5 129697758 missense probably benign 0.05
R6815:Sept14 UTSW 5 129692987 missense probably benign
R7064:Sept14 UTSW 5 129697806 missense probably benign 0.00
R7703:Sept14 UTSW 5 129686028 missense possibly damaging 0.63
R7734:Sept14 UTSW 5 129683519 missense probably benign
X0066:Sept14 UTSW 5 129689538 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TATACAGCACTCTCGTGGAGGAC -3'
(R):5'- AGCCCCGGGGTTTTAAATACG -3'

Sequencing Primer
(F):5'- GACGACACGTGCTGAAACATTTTTG -3'
(R):5'- AAATACGTTTTTCTAGGGTCATGGTC -3'
Posted On2016-08-04