Incidental Mutation 'R5393:Dyrk2'
ID425967
Institutional Source Beutler Lab
Gene Symbol Dyrk2
Ensembl Gene ENSMUSG00000028630
Gene Namedual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2
Synonyms1810038L18Rik
MMRRC Submission 042965-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.486) question?
Stock #R5393 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location118855603-118870209 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 118859848 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 502 (D502N)
Ref Sequence ENSEMBL: ENSMUSP00000004281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004281]
Predicted Effect probably damaging
Transcript: ENSMUST00000004281
AA Change: D502N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000004281
Gene: ENSMUSG00000028630
AA Change: D502N

DomainStartEndE-ValueType
S_TKc 220 533 1.16e-92 SMART
low complexity region 560 574 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218692
Meta Mutation Damage Score 0.1516 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DYRK2 belongs to a family of protein kinases whose members are presumed to be involved in cellular growth and/or development. The family is defined by structural similarity of their kinase domains and their capability to autophosphorylate on tyrosine residues. DYRK2 has demonstrated tyrosine autophosphorylation and catalyzed phosphorylation of histones H3 and H2B in vitro. Two isoforms of DYRK2 have been isolated. The predominant isoform, isoform 1, lacks a 5' terminal insert. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik A T 16: 89,063,765 Y60* probably null Het
2810403A07Rik T A 3: 88,696,606 H243Q probably benign Het
Abca6 T A 11: 110,244,295 E221D probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adi1 A G 12: 28,675,275 D8G probably benign Het
Adnp T C 2: 168,182,949 K809E possibly damaging Het
Aldh18a1 T C 19: 40,585,567 H4R probably benign Het
Atp6v0a1 T C 11: 101,038,807 S485P possibly damaging Het
C1galt1 T C 6: 7,864,143 probably null Het
Cacna2d4 A T 6: 119,239,054 N94I probably benign Het
Catsperg1 T C 7: 29,185,499 N899S probably damaging Het
Coro2a A G 4: 46,542,255 S373P probably damaging Het
Cpsf6 G C 10: 117,362,016 probably benign Het
Csmd3 A T 15: 47,633,703 N3099K probably damaging Het
Ctla2b T A 13: 60,896,132 E74D probably damaging Het
Dnah2 T A 11: 69,500,857 T671S probably benign Het
Drd5 T A 5: 38,320,905 S414T probably benign Het
Ecel1 A T 1: 87,152,876 L376Q possibly damaging Het
Efcab8 G A 2: 153,780,983 R24Q unknown Het
Eloc A C 1: 16,647,968 probably benign Het
Ep300 A G 15: 81,631,618 probably benign Het
Fam89b T C 19: 5,728,705 D152G probably damaging Het
Gm15455 G A 1: 33,836,846 noncoding transcript Het
Greb1l A G 18: 10,458,312 T30A probably benign Het
Hdac10 T C 15: 89,126,684 Y238C probably damaging Het
Ick A G 9: 78,160,715 T463A probably benign Het
Ighv2-5 T C 12: 113,685,882 T12A possibly damaging Het
Insrr T C 3: 87,810,700 probably null Het
Irf9 T C 14: 55,606,457 probably benign Het
Itpr2 A T 6: 146,376,155 C280* probably null Het
Kcnk18 T C 19: 59,219,839 C36R probably damaging Het
Klhl14 G T 18: 21,651,994 N125K probably benign Het
Lce1i T C 3: 92,777,735 S45G unknown Het
Lrmda A C 14: 22,027,306 D37A probably damaging Het
Marco A C 1: 120,485,854 D280E probably damaging Het
Miox C T 15: 89,336,247 Q180* probably null Het
Npdc1 A T 2: 25,408,670 M265L probably damaging Het
Nudcd3 T C 11: 6,113,274 K205R probably damaging Het
Olfr319 T A 11: 58,702,500 H266Q probably damaging Het
Olfr325 C G 11: 58,580,999 L52V possibly damaging Het
Pcdhga5 C T 18: 37,696,667 R723C probably benign Het
Pdlim5 T A 3: 142,259,186 E295D probably damaging Het
Poli C A 18: 70,517,428 E314* probably null Het
Ptpro A G 6: 137,380,224 N238D probably benign Het
R3hdm1 A G 1: 128,231,347 I920V probably benign Het
Ralgapa2 C T 2: 146,345,455 V1338M probably damaging Het
Saa3 T C 7: 46,712,661 Y53C probably damaging Het
Sept14 T A 5: 129,683,586 E398D probably benign Het
Six3 T C 17: 85,623,842 S309P possibly damaging Het
Slc7a14 A G 3: 31,257,770 S34P probably damaging Het
Smarca2 C A 19: 26,640,429 Q287K probably benign Het
Stard9 C T 2: 120,702,906 L522F possibly damaging Het
Sycp1 T C 3: 102,841,047 probably null Het
Tbc1d8 A T 1: 39,426,088 V73E probably damaging Het
Tldc1 T C 8: 119,772,418 I112V probably benign Het
Tmem120a T C 5: 135,736,250 probably null Het
Tsc2 T C 17: 24,600,396 E1251G possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnt5b A C 6: 119,440,433 L157R probably damaging Het
Zbtb24 T A 10: 41,464,582 V536E probably damaging Het
Zfp593 G A 4: 134,245,304 A67V probably benign Het
Zfp995 A T 17: 21,880,492 F254I probably benign Het
Other mutations in Dyrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Dyrk2 APN 10 118859844 missense probably damaging 1.00
IGL00536:Dyrk2 APN 10 118860192 missense probably damaging 1.00
IGL01288:Dyrk2 APN 10 118860699 missense probably damaging 1.00
IGL01375:Dyrk2 APN 10 118860687 missense probably damaging 1.00
IGL01637:Dyrk2 APN 10 118860507 missense probably damaging 1.00
IGL02052:Dyrk2 APN 10 118860543 missense probably damaging 1.00
R0452:Dyrk2 UTSW 10 118868763 missense possibly damaging 0.91
R0833:Dyrk2 UTSW 10 118861122 missense probably benign 0.00
R0836:Dyrk2 UTSW 10 118861122 missense probably benign 0.00
R1346:Dyrk2 UTSW 10 118859719 missense possibly damaging 0.92
R1610:Dyrk2 UTSW 10 118859925 missense probably benign 0.02
R2397:Dyrk2 UTSW 10 118861368 intron probably benign
R2409:Dyrk2 UTSW 10 118860627 missense probably benign
R2965:Dyrk2 UTSW 10 118860337 nonsense probably null
R2966:Dyrk2 UTSW 10 118860337 nonsense probably null
R4700:Dyrk2 UTSW 10 118868286 missense probably benign
R4896:Dyrk2 UTSW 10 118868248 missense probably damaging 0.96
R4978:Dyrk2 UTSW 10 118860347 missense probably benign 0.00
R5442:Dyrk2 UTSW 10 118860738 missense possibly damaging 0.72
R5496:Dyrk2 UTSW 10 118860051 missense probably damaging 1.00
R5810:Dyrk2 UTSW 10 118860340 missense probably benign 0.16
R5875:Dyrk2 UTSW 10 118860697 missense probably damaging 1.00
R5930:Dyrk2 UTSW 10 118860268 missense probably damaging 1.00
R6877:Dyrk2 UTSW 10 118860423 missense probably damaging 1.00
R7234:Dyrk2 UTSW 10 118860231 missense possibly damaging 0.84
R7442:Dyrk2 UTSW 10 118859881 missense probably damaging 1.00
R7741:Dyrk2 UTSW 10 118859689 missense probably benign
R8108:Dyrk2 UTSW 10 118859829 missense probably benign 0.27
R8137:Dyrk2 UTSW 10 118859884 missense probably benign 0.00
R8347:Dyrk2 UTSW 10 118859983 missense probably damaging 0.99
R8507:Dyrk2 UTSW 10 118860662 missense probably damaging 1.00
R8517:Dyrk2 UTSW 10 118861021 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCAAGTTAGTCCTCAGCTTGG -3'
(R):5'- TCAGAAACTCCTGGATGCTTCC -3'

Sequencing Primer
(F):5'- CTTGGAAGCTGAACTGGAGG -3'
(R):5'- GGATGCTTCCAAACGAGCC -3'
Posted On2016-08-04