Incidental Mutation 'R5393:Abca6'
ID425973
Institutional Source Beutler Lab
Gene Symbol Abca6
Ensembl Gene ENSMUSG00000044749
Gene NameATP-binding cassette, sub-family A (ABC1), member 6
Synonyms6330565N06Rik
MMRRC Submission 042965-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5393 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location110176820-110251776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110244295 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 221 (E221D)
Ref Sequence ENSEMBL: ENSMUSP00000035458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044003]
Predicted Effect probably benign
Transcript: ENSMUST00000044003
AA Change: E221D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000035458
Gene: ENSMUSG00000044749
AA Change: E221D

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 416 1.4e-42 PFAM
low complexity region 484 495 N/A INTRINSIC
AAA 506 691 1.13e-6 SMART
transmembrane domain 854 876 N/A INTRINSIC
transmembrane domain 971 990 N/A INTRINSIC
transmembrane domain 1005 1027 N/A INTRINSIC
Blast:AAA 1041 1176 4e-21 BLAST
transmembrane domain 1191 1213 N/A INTRINSIC
low complexity region 1243 1254 N/A INTRINSIC
AAA 1312 1505 2.43e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150988
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24 and may play a role in macrophage lipid homeostasis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik A T 16: 89,063,765 Y60* probably null Het
2810403A07Rik T A 3: 88,696,606 H243Q probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adi1 A G 12: 28,675,275 D8G probably benign Het
Adnp T C 2: 168,182,949 K809E possibly damaging Het
Aldh18a1 T C 19: 40,585,567 H4R probably benign Het
Atp6v0a1 T C 11: 101,038,807 S485P possibly damaging Het
C1galt1 T C 6: 7,864,143 probably null Het
Cacna2d4 A T 6: 119,239,054 N94I probably benign Het
Catsperg1 T C 7: 29,185,499 N899S probably damaging Het
Coro2a A G 4: 46,542,255 S373P probably damaging Het
Cpsf6 G C 10: 117,362,016 probably benign Het
Csmd3 A T 15: 47,633,703 N3099K probably damaging Het
Ctla2b T A 13: 60,896,132 E74D probably damaging Het
Dnah2 T A 11: 69,500,857 T671S probably benign Het
Drd5 T A 5: 38,320,905 S414T probably benign Het
Dyrk2 C T 10: 118,859,848 D502N probably damaging Het
Ecel1 A T 1: 87,152,876 L376Q possibly damaging Het
Efcab8 G A 2: 153,780,983 R24Q unknown Het
Eloc A C 1: 16,647,968 probably benign Het
Ep300 A G 15: 81,631,618 probably benign Het
Fam89b T C 19: 5,728,705 D152G probably damaging Het
Gm15455 G A 1: 33,836,846 noncoding transcript Het
Greb1l A G 18: 10,458,312 T30A probably benign Het
Hdac10 T C 15: 89,126,684 Y238C probably damaging Het
Ick A G 9: 78,160,715 T463A probably benign Het
Ighv2-5 T C 12: 113,685,882 T12A possibly damaging Het
Insrr T C 3: 87,810,700 probably null Het
Irf9 T C 14: 55,606,457 probably benign Het
Itpr2 A T 6: 146,376,155 C280* probably null Het
Kcnk18 T C 19: 59,219,839 C36R probably damaging Het
Klhl14 G T 18: 21,651,994 N125K probably benign Het
Lce1i T C 3: 92,777,735 S45G unknown Het
Lrmda A C 14: 22,027,306 D37A probably damaging Het
Marco A C 1: 120,485,854 D280E probably damaging Het
Miox C T 15: 89,336,247 Q180* probably null Het
Npdc1 A T 2: 25,408,670 M265L probably damaging Het
Nudcd3 T C 11: 6,113,274 K205R probably damaging Het
Olfr319 T A 11: 58,702,500 H266Q probably damaging Het
Olfr325 C G 11: 58,580,999 L52V possibly damaging Het
Pcdhga5 C T 18: 37,696,667 R723C probably benign Het
Pdlim5 T A 3: 142,259,186 E295D probably damaging Het
Poli C A 18: 70,517,428 E314* probably null Het
Ptpro A G 6: 137,380,224 N238D probably benign Het
R3hdm1 A G 1: 128,231,347 I920V probably benign Het
Ralgapa2 C T 2: 146,345,455 V1338M probably damaging Het
Saa3 T C 7: 46,712,661 Y53C probably damaging Het
Sept14 T A 5: 129,683,586 E398D probably benign Het
Six3 T C 17: 85,623,842 S309P possibly damaging Het
Slc7a14 A G 3: 31,257,770 S34P probably damaging Het
Smarca2 C A 19: 26,640,429 Q287K probably benign Het
Stard9 C T 2: 120,702,906 L522F possibly damaging Het
Sycp1 T C 3: 102,841,047 probably null Het
Tbc1d8 A T 1: 39,426,088 V73E probably damaging Het
Tldc1 T C 8: 119,772,418 I112V probably benign Het
Tmem120a T C 5: 135,736,250 probably null Het
Tsc2 T C 17: 24,600,396 E1251G possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnt5b A C 6: 119,440,433 L157R probably damaging Het
Zbtb24 T A 10: 41,464,582 V536E probably damaging Het
Zfp593 G A 4: 134,245,304 A67V probably benign Het
Zfp995 A T 17: 21,880,492 F254I probably benign Het
Other mutations in Abca6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca6 APN 11 110184709 missense probably damaging 1.00
IGL00569:Abca6 APN 11 110187049 missense possibly damaging 0.88
IGL00737:Abca6 APN 11 110196997 splice site probably benign
IGL01024:Abca6 APN 11 110197142 missense probably benign
IGL01087:Abca6 APN 11 110191650 missense probably benign 0.00
IGL01511:Abca6 APN 11 110244310 missense probably benign 0.00
IGL01516:Abca6 APN 11 110218217 missense possibly damaging 0.70
IGL01621:Abca6 APN 11 110184708 missense probably damaging 1.00
IGL01749:Abca6 APN 11 110244224 missense probably damaging 1.00
IGL01934:Abca6 APN 11 110188655 missense probably benign 0.00
IGL02010:Abca6 APN 11 110219616 missense probably benign 0.12
IGL02121:Abca6 APN 11 110182924 missense probably benign 0.38
IGL02423:Abca6 APN 11 110219006 splice site probably benign
IGL02428:Abca6 APN 11 110178792 missense possibly damaging 0.81
IGL02491:Abca6 APN 11 110176968 utr 3 prime probably benign
IGL02541:Abca6 APN 11 110212267 missense probably damaging 1.00
IGL02792:Abca6 APN 11 110188681 missense probably damaging 0.99
IGL02836:Abca6 APN 11 110248548 missense probably damaging 1.00
IGL02965:Abca6 APN 11 110180613 missense probably benign
IGL03094:Abca6 APN 11 110184112 missense probably benign 0.03
IGL03109:Abca6 APN 11 110180347 missense probably damaging 0.96
R0068:Abca6 UTSW 11 110182882 missense probably damaging 1.00
R0142:Abca6 UTSW 11 110188641 missense probably damaging 1.00
R0165:Abca6 UTSW 11 110219604 missense possibly damaging 0.90
R0254:Abca6 UTSW 11 110236789 missense probably benign 0.16
R0598:Abca6 UTSW 11 110197154 missense probably damaging 1.00
R0992:Abca6 UTSW 11 110211684 missense probably damaging 1.00
R1386:Abca6 UTSW 11 110244255 missense probably benign 0.02
R1642:Abca6 UTSW 11 110218281 missense possibly damaging 0.73
R1673:Abca6 UTSW 11 110212339 missense probably benign 0.01
R1792:Abca6 UTSW 11 110184044 missense probably benign 0.00
R1813:Abca6 UTSW 11 110233845 splice site probably benign
R1817:Abca6 UTSW 11 110219318 missense probably benign 0.00
R1842:Abca6 UTSW 11 110197039 missense probably benign 0.00
R1898:Abca6 UTSW 11 110208799 missense probably damaging 0.99
R1914:Abca6 UTSW 11 110212210 missense probably benign 0.06
R1915:Abca6 UTSW 11 110212210 missense probably benign 0.06
R1934:Abca6 UTSW 11 110210083 critical splice donor site probably null
R1964:Abca6 UTSW 11 110184676 missense probably damaging 0.98
R1967:Abca6 UTSW 11 110187148 missense probably benign 0.09
R2127:Abca6 UTSW 11 110219649 missense probably benign 0.00
R2128:Abca6 UTSW 11 110219649 missense probably benign 0.00
R2164:Abca6 UTSW 11 110210193 frame shift probably null
R2895:Abca6 UTSW 11 110202426 missense probably benign 0.00
R3110:Abca6 UTSW 11 110178829 nonsense probably null
R3111:Abca6 UTSW 11 110178829 nonsense probably null
R3112:Abca6 UTSW 11 110178829 nonsense probably null
R4094:Abca6 UTSW 11 110180366 missense probably damaging 1.00
R4432:Abca6 UTSW 11 110241588 missense probably benign 0.11
R4474:Abca6 UTSW 11 110233772 missense possibly damaging 0.46
R4572:Abca6 UTSW 11 110216548 missense probably benign 0.31
R4629:Abca6 UTSW 11 110230549 critical splice acceptor site probably null
R4793:Abca6 UTSW 11 110191718 missense probably benign
R4852:Abca6 UTSW 11 110244203 missense probably benign 0.09
R4867:Abca6 UTSW 11 110202379 missense probably benign 0.01
R4879:Abca6 UTSW 11 110219700 missense probably damaging 0.98
R4918:Abca6 UTSW 11 110180551 missense probably damaging 1.00
R5060:Abca6 UTSW 11 110219604 missense possibly damaging 0.90
R5062:Abca6 UTSW 11 110177066 missense probably benign 0.12
R5083:Abca6 UTSW 11 110218967 missense probably damaging 1.00
R5173:Abca6 UTSW 11 110191720 missense probably benign
R5484:Abca6 UTSW 11 110184073 missense probably damaging 1.00
R5498:Abca6 UTSW 11 110208844 missense possibly damaging 0.95
R5503:Abca6 UTSW 11 110218257 missense probably damaging 1.00
R5645:Abca6 UTSW 11 110250408 missense probably damaging 0.99
R5680:Abca6 UTSW 11 110236645 missense possibly damaging 0.88
R5761:Abca6 UTSW 11 110210101 missense probably damaging 1.00
R5779:Abca6 UTSW 11 110184670 missense probably benign 0.37
R5818:Abca6 UTSW 11 110219643 missense probably damaging 1.00
R6282:Abca6 UTSW 11 110208824 missense probably damaging 0.98
R6455:Abca6 UTSW 11 110241581 missense probably damaging 1.00
R6826:Abca6 UTSW 11 110216605 missense probably benign 0.15
R6857:Abca6 UTSW 11 110219688 missense possibly damaging 0.63
R6914:Abca6 UTSW 11 110190238 missense probably benign
R6931:Abca6 UTSW 11 110244328 missense probably benign 0.27
R7222:Abca6 UTSW 11 110191693 missense probably benign 0.29
R7242:Abca6 UTSW 11 110241653 missense possibly damaging 0.47
R7297:Abca6 UTSW 11 110183026 critical splice donor site probably null
R7387:Abca6 UTSW 11 110202420 missense probably benign
R7420:Abca6 UTSW 11 110250477 missense probably benign 0.24
R7494:Abca6 UTSW 11 110208745 missense possibly damaging 0.93
R7603:Abca6 UTSW 11 110180258 missense possibly damaging 0.69
R7637:Abca6 UTSW 11 110218952 missense probably benign 0.00
R7674:Abca6 UTSW 11 110219297 missense probably damaging 1.00
X0024:Abca6 UTSW 11 110244255 missense probably benign 0.02
X0064:Abca6 UTSW 11 110197142 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCAATAGTGAGCACGGACAAC -3'
(R):5'- ACCTCCAAGGCTTATTCTAGC -3'

Sequencing Primer
(F):5'- TGTCAAAGGCAACCCGTG -3'
(R):5'- CCAAGGCTTATTCTAGCTCTGTC -3'
Posted On2016-08-04