Incidental Mutation 'R5393:Greb1l'
ID425987
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Namegrowth regulation by estrogen in breast cancer-like
SynonymsAK220484, mKIAA4095
MMRRC Submission 042965-MU
Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5393 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location10325177-10562934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10458312 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 30 (T30A)
Ref Sequence ENSEMBL: ENSMUSP00000134090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532]
Predicted Effect probably benign
Transcript: ENSMUST00000048977
AA Change: T30A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: T30A

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172532
AA Change: T30A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: T30A

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173356
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (72/73)
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik A T 16: 89,063,765 Y60* probably null Het
2810403A07Rik T A 3: 88,696,606 H243Q probably benign Het
Abca6 T A 11: 110,244,295 E221D probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adi1 A G 12: 28,675,275 D8G probably benign Het
Adnp T C 2: 168,182,949 K809E possibly damaging Het
Aldh18a1 T C 19: 40,585,567 H4R probably benign Het
Atp6v0a1 T C 11: 101,038,807 S485P possibly damaging Het
C1galt1 T C 6: 7,864,143 probably null Het
Cacna2d4 A T 6: 119,239,054 N94I probably benign Het
Catsperg1 T C 7: 29,185,499 N899S probably damaging Het
Coro2a A G 4: 46,542,255 S373P probably damaging Het
Cpsf6 G C 10: 117,362,016 probably benign Het
Csmd3 A T 15: 47,633,703 N3099K probably damaging Het
Ctla2b T A 13: 60,896,132 E74D probably damaging Het
Dnah2 T A 11: 69,500,857 T671S probably benign Het
Drd5 T A 5: 38,320,905 S414T probably benign Het
Dyrk2 C T 10: 118,859,848 D502N probably damaging Het
Ecel1 A T 1: 87,152,876 L376Q possibly damaging Het
Efcab8 G A 2: 153,780,983 R24Q unknown Het
Eloc A C 1: 16,647,968 probably benign Het
Ep300 A G 15: 81,631,618 probably benign Het
Fam89b T C 19: 5,728,705 D152G probably damaging Het
Gm15455 G A 1: 33,836,846 noncoding transcript Het
Hdac10 T C 15: 89,126,684 Y238C probably damaging Het
Ick A G 9: 78,160,715 T463A probably benign Het
Ighv2-5 T C 12: 113,685,882 T12A possibly damaging Het
Insrr T C 3: 87,810,700 probably null Het
Irf9 T C 14: 55,606,457 probably benign Het
Itpr2 A T 6: 146,376,155 C280* probably null Het
Kcnk18 T C 19: 59,219,839 C36R probably damaging Het
Klhl14 G T 18: 21,651,994 N125K probably benign Het
Lce1i T C 3: 92,777,735 S45G unknown Het
Lrmda A C 14: 22,027,306 D37A probably damaging Het
Marco A C 1: 120,485,854 D280E probably damaging Het
Miox C T 15: 89,336,247 Q180* probably null Het
Npdc1 A T 2: 25,408,670 M265L probably damaging Het
Nudcd3 T C 11: 6,113,274 K205R probably damaging Het
Olfr319 T A 11: 58,702,500 H266Q probably damaging Het
Olfr325 C G 11: 58,580,999 L52V possibly damaging Het
Pcdhga5 C T 18: 37,696,667 R723C probably benign Het
Pdlim5 T A 3: 142,259,186 E295D probably damaging Het
Poli C A 18: 70,517,428 E314* probably null Het
Ptpro A G 6: 137,380,224 N238D probably benign Het
R3hdm1 A G 1: 128,231,347 I920V probably benign Het
Ralgapa2 C T 2: 146,345,455 V1338M probably damaging Het
Saa3 T C 7: 46,712,661 Y53C probably damaging Het
Sept14 T A 5: 129,683,586 E398D probably benign Het
Six3 T C 17: 85,623,842 S309P possibly damaging Het
Slc7a14 A G 3: 31,257,770 S34P probably damaging Het
Smarca2 C A 19: 26,640,429 Q287K probably benign Het
Stard9 C T 2: 120,702,906 L522F possibly damaging Het
Sycp1 T C 3: 102,841,047 probably null Het
Tbc1d8 A T 1: 39,426,088 V73E probably damaging Het
Tldc1 T C 8: 119,772,418 I112V probably benign Het
Tmem120a T C 5: 135,736,250 probably null Het
Tsc2 T C 17: 24,600,396 E1251G possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnt5b A C 6: 119,440,433 L157R probably damaging Het
Zbtb24 T A 10: 41,464,582 V536E probably damaging Het
Zfp593 G A 4: 134,245,304 A67V probably benign Het
Zfp995 A T 17: 21,880,492 F254I probably benign Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10555962 missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10522144 missense probably benign 0.01
IGL01563:Greb1l APN 18 10469399 missense probably damaging 0.99
IGL01944:Greb1l APN 18 10557280 missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10515271 missense probably damaging 1.00
IGL02249:Greb1l APN 18 10532961 missense probably damaging 1.00
IGL02318:Greb1l APN 18 10469388 missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10515200 missense probably damaging 0.99
IGL02516:Greb1l APN 18 10537064 missense probably benign 0.31
IGL02566:Greb1l APN 18 10503299 missense probably damaging 0.99
IGL02583:Greb1l APN 18 10542362 missense probably damaging 1.00
IGL02838:Greb1l APN 18 10560430 missense probably damaging 1.00
A4554:Greb1l UTSW 18 10532862 missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10533031 missense probably damaging 0.98
PIT4453001:Greb1l UTSW 18 10533032 missense probably benign 0.08
R0099:Greb1l UTSW 18 10509158 missense probably damaging 1.00
R0226:Greb1l UTSW 18 10522076 intron probably benign
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0239:Greb1l UTSW 18 10458567 splice site probably benign
R0316:Greb1l UTSW 18 10547420 missense probably damaging 1.00
R0369:Greb1l UTSW 18 10469375 missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10523374 missense probably damaging 0.99
R0478:Greb1l UTSW 18 10509281 missense probably damaging 1.00
R0555:Greb1l UTSW 18 10458781 splice site probably benign
R0671:Greb1l UTSW 18 10474303 missense probably damaging 1.00
R1282:Greb1l UTSW 18 10547289 missense probably benign 0.13
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10529703 missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10501080 critical splice donor site probably null
R1666:Greb1l UTSW 18 10529708 critical splice donor site probably null
R1720:Greb1l UTSW 18 10553848 missense probably benign 0.19
R1808:Greb1l UTSW 18 10542143 missense probably benign
R1829:Greb1l UTSW 18 10509314 missense probably damaging 1.00
R1897:Greb1l UTSW 18 10498992 missense probably benign 0.00
R1967:Greb1l UTSW 18 10501049 missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10515221 missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10523281 missense probably damaging 1.00
R2125:Greb1l UTSW 18 10511422 missense probably damaging 0.98
R2139:Greb1l UTSW 18 10555011 missense probably damaging 1.00
R2255:Greb1l UTSW 18 10554857 missense probably damaging 1.00
R2256:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10547288 missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10542380 missense probably damaging 0.99
R3778:Greb1l UTSW 18 10469444 missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10522247 missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10515209 missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10522150 missense probably damaging 0.99
R4134:Greb1l UTSW 18 10529708 critical splice donor site probably null
R4342:Greb1l UTSW 18 10544561 missense probably benign 0.12
R4409:Greb1l UTSW 18 10503182 missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10553705 missense probably damaging 1.00
R4618:Greb1l UTSW 18 10498965 missense probably benign 0.00
R4683:Greb1l UTSW 18 10529563 splice site probably null
R4686:Greb1l UTSW 18 10522112 missense probably damaging 0.98
R4707:Greb1l UTSW 18 10532922 missense probably benign 0.02
R4780:Greb1l UTSW 18 10541792 missense probably benign 0.00
R4819:Greb1l UTSW 18 10458358 missense probably damaging 1.00
R4925:Greb1l UTSW 18 10547447 missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10547306 missense probably damaging 0.99
R5150:Greb1l UTSW 18 10555950 frame shift probably null
R5154:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5269:Greb1l UTSW 18 10511409 missense probably benign
R5290:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5310:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5328:Greb1l UTSW 18 10553720 missense probably damaging 1.00
R5337:Greb1l UTSW 18 10509143 missense probably damaging 1.00
R5402:Greb1l UTSW 18 10537169 missense probably benign 0.26
R5718:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5719:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5720:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5721:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5902:Greb1l UTSW 18 10538302 missense probably benign 0.00
R5993:Greb1l UTSW 18 10544455 missense probably benign 0.10
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10547068 missense probably damaging 1.00
R6063:Greb1l UTSW 18 10557340 missense probably damaging 1.00
R6297:Greb1l UTSW 18 10469494 missense probably damaging 1.00
R6405:Greb1l UTSW 18 10501076 missense probably benign 0.30
R6552:Greb1l UTSW 18 10541814 missense probably benign 0.00
R6572:Greb1l UTSW 18 10522131 missense probably benign 0.07
R6575:Greb1l UTSW 18 10547347 missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10547482 missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10558786 missense probably benign 0.23
R6962:Greb1l UTSW 18 10547327 missense probably damaging 1.00
R7012:Greb1l UTSW 18 10529707 critical splice donor site probably null
R7179:Greb1l UTSW 18 10544576 missense probably benign 0.00
R7251:Greb1l UTSW 18 10515319 missense probably damaging 1.00
R7275:Greb1l UTSW 18 10544561 missense probably benign 0.12
R7301:Greb1l UTSW 18 10544970 missense probably damaging 1.00
R7307:Greb1l UTSW 18 10538142 missense probably damaging 0.99
R7455:Greb1l UTSW 18 10554915 missense probably damaging 1.00
R7832:Greb1l UTSW 18 10542056 missense probably benign 0.38
R7934:Greb1l UTSW 18 10474371 nonsense probably null
R8137:Greb1l UTSW 18 10474357 missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10533060 missense probably benign 0.13
R8208:Greb1l UTSW 18 10510703 missense probably damaging 1.00
R8227:Greb1l UTSW 18 10515371 missense probably damaging 1.00
R8312:Greb1l UTSW 18 10511587 intron probably benign
R8331:Greb1l UTSW 18 10458706 missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10529687 missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10529613 missense probably benign 0.00
Z1176:Greb1l UTSW 18 10515305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTCTACTGATCATGGGCAGG -3'
(R):5'- CTGTTTAAACGAGGAAACCAATGC -3'

Sequencing Primer
(F):5'- GTTTTCAGAAGAGGTCCAGATCCC -3'
(R):5'- CTGAAAGATAACTTTGAGGAGGGG -3'
Posted On2016-08-04