Incidental Mutation 'R5393:Greb1l'
ID 425987
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Name growth regulation by estrogen in breast cancer-like
Synonyms mKIAA4095, AK220484
MMRRC Submission 042965-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5393 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 10325177-10562940 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 10458312 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 30 (T30A)
Ref Sequence ENSEMBL: ENSMUSP00000134090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532]
AlphaFold B9EJV3
Predicted Effect probably benign
Transcript: ENSMUST00000048977
AA Change: T30A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: T30A

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172532
AA Change: T30A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: T30A

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173356
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (72/73)
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik A T 16: 88,860,653 (GRCm39) Y60* probably null Het
Abca6 T A 11: 110,135,121 (GRCm39) E221D probably benign Het
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Adi1 A G 12: 28,725,274 (GRCm39) D8G probably benign Het
Adnp T C 2: 168,024,869 (GRCm39) K809E possibly damaging Het
Aldh18a1 T C 19: 40,574,011 (GRCm39) H4R probably benign Het
Atp6v0a1 T C 11: 100,929,633 (GRCm39) S485P possibly damaging Het
C1galt1 T C 6: 7,864,143 (GRCm39) probably null Het
Cacna2d4 A T 6: 119,216,015 (GRCm39) N94I probably benign Het
Catsperg1 T C 7: 28,884,924 (GRCm39) N899S probably damaging Het
Cilk1 A G 9: 78,067,997 (GRCm39) T463A probably benign Het
Coro2a A G 4: 46,542,255 (GRCm39) S373P probably damaging Het
Cpsf6 G C 10: 117,197,921 (GRCm39) probably benign Het
Csmd3 A T 15: 47,497,099 (GRCm39) N3099K probably damaging Het
Ctla2b T A 13: 61,043,946 (GRCm39) E74D probably damaging Het
Dnah2 T A 11: 69,391,683 (GRCm39) T671S probably benign Het
Drd5 T A 5: 38,478,248 (GRCm39) S414T probably benign Het
Dyrk2 C T 10: 118,695,753 (GRCm39) D502N probably damaging Het
Ecel1 A T 1: 87,080,598 (GRCm39) L376Q possibly damaging Het
Efcab8 G A 2: 153,622,903 (GRCm39) R24Q unknown Het
Eloc A C 1: 16,718,192 (GRCm39) probably benign Het
Ep300 A G 15: 81,515,819 (GRCm39) probably benign Het
Fam89b T C 19: 5,778,733 (GRCm39) D152G probably damaging Het
Gm15455 G A 1: 33,875,927 (GRCm39) noncoding transcript Het
Hdac10 T C 15: 89,010,887 (GRCm39) Y238C probably damaging Het
Ighv2-5 T C 12: 113,649,502 (GRCm39) T12A possibly damaging Het
Insrr T C 3: 87,718,007 (GRCm39) probably null Het
Irf9 T C 14: 55,843,914 (GRCm39) probably benign Het
Itpr2 A T 6: 146,277,653 (GRCm39) C280* probably null Het
Kcnk18 T C 19: 59,208,271 (GRCm39) C36R probably damaging Het
Khdc4 T A 3: 88,603,913 (GRCm39) H243Q probably benign Het
Klhl14 G T 18: 21,785,051 (GRCm39) N125K probably benign Het
Lce1i T C 3: 92,685,042 (GRCm39) S45G unknown Het
Lrmda A C 14: 22,077,374 (GRCm39) D37A probably damaging Het
Marco A C 1: 120,413,583 (GRCm39) D280E probably damaging Het
Meak7 T C 8: 120,499,157 (GRCm39) I112V probably benign Het
Miox C T 15: 89,220,450 (GRCm39) Q180* probably null Het
Npdc1 A T 2: 25,298,682 (GRCm39) M265L probably damaging Het
Nudcd3 T C 11: 6,063,274 (GRCm39) K205R probably damaging Het
Or2ak6 T A 11: 58,593,326 (GRCm39) H266Q probably damaging Het
Or2t46 C G 11: 58,471,825 (GRCm39) L52V possibly damaging Het
Pcdhga5 C T 18: 37,829,720 (GRCm39) R723C probably benign Het
Pdlim5 T A 3: 141,964,947 (GRCm39) E295D probably damaging Het
Poli C A 18: 70,650,499 (GRCm39) E314* probably null Het
Ptpro A G 6: 137,357,222 (GRCm39) N238D probably benign Het
R3hdm1 A G 1: 128,159,084 (GRCm39) I920V probably benign Het
Ralgapa2 C T 2: 146,187,375 (GRCm39) V1338M probably damaging Het
Saa3 T C 7: 46,362,085 (GRCm39) Y53C probably damaging Het
Septin14 T A 5: 129,760,650 (GRCm39) E398D probably benign Het
Six3 T C 17: 85,931,270 (GRCm39) S309P possibly damaging Het
Slc7a14 A G 3: 31,311,919 (GRCm39) S34P probably damaging Het
Smarca2 C A 19: 26,617,829 (GRCm39) Q287K probably benign Het
Stard9 C T 2: 120,533,387 (GRCm39) L522F possibly damaging Het
Sycp1 T C 3: 102,748,363 (GRCm39) probably null Het
Tbc1d8 A T 1: 39,465,169 (GRCm39) V73E probably damaging Het
Tmem120a T C 5: 135,765,104 (GRCm39) probably null Het
Tsc2 T C 17: 24,819,370 (GRCm39) E1251G possibly damaging Het
Vps51 T G 19: 6,121,063 (GRCm39) E283D probably benign Het
Wnt5b A C 6: 119,417,394 (GRCm39) L157R probably damaging Het
Zbtb24 T A 10: 41,340,578 (GRCm39) V536E probably damaging Het
Zfp593 G A 4: 133,972,615 (GRCm39) A67V probably benign Het
Zfp995 A T 17: 22,099,473 (GRCm39) F254I probably benign Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10,555,962 (GRCm39) missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10,522,144 (GRCm39) missense probably benign 0.01
IGL01563:Greb1l APN 18 10,469,399 (GRCm39) missense probably damaging 0.99
IGL01944:Greb1l APN 18 10,557,280 (GRCm39) missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10,515,271 (GRCm39) missense probably damaging 1.00
IGL02249:Greb1l APN 18 10,532,961 (GRCm39) missense probably damaging 1.00
IGL02318:Greb1l APN 18 10,469,388 (GRCm39) missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10,515,200 (GRCm39) missense probably damaging 0.99
IGL02516:Greb1l APN 18 10,537,064 (GRCm39) missense probably benign 0.31
IGL02566:Greb1l APN 18 10,503,299 (GRCm39) missense probably damaging 0.99
IGL02583:Greb1l APN 18 10,542,362 (GRCm39) missense probably damaging 1.00
IGL02838:Greb1l APN 18 10,560,430 (GRCm39) missense probably damaging 1.00
A4554:Greb1l UTSW 18 10,532,862 (GRCm39) missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10,533,032 (GRCm39) missense probably benign 0.08
PIT4453001:Greb1l UTSW 18 10,533,031 (GRCm39) missense probably damaging 0.98
R0099:Greb1l UTSW 18 10,509,158 (GRCm39) missense probably damaging 1.00
R0226:Greb1l UTSW 18 10,522,076 (GRCm39) intron probably benign
R0234:Greb1l UTSW 18 10,560,331 (GRCm39) missense probably damaging 1.00
R0234:Greb1l UTSW 18 10,560,331 (GRCm39) missense probably damaging 1.00
R0239:Greb1l UTSW 18 10,458,567 (GRCm39) splice site probably benign
R0316:Greb1l UTSW 18 10,547,420 (GRCm39) missense probably damaging 1.00
R0369:Greb1l UTSW 18 10,469,375 (GRCm39) missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10,523,374 (GRCm39) missense probably damaging 0.99
R0478:Greb1l UTSW 18 10,509,281 (GRCm39) missense probably damaging 1.00
R0555:Greb1l UTSW 18 10,458,781 (GRCm39) splice site probably benign
R0671:Greb1l UTSW 18 10,474,303 (GRCm39) missense probably damaging 1.00
R1282:Greb1l UTSW 18 10,547,289 (GRCm39) missense probably benign 0.13
R1574:Greb1l UTSW 18 10,554,997 (GRCm39) missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10,554,997 (GRCm39) missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10,529,703 (GRCm39) missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10,529,708 (GRCm39) critical splice donor site probably null
R1666:Greb1l UTSW 18 10,501,080 (GRCm39) critical splice donor site probably null
R1720:Greb1l UTSW 18 10,553,848 (GRCm39) missense probably benign 0.19
R1808:Greb1l UTSW 18 10,542,143 (GRCm39) missense probably benign
R1829:Greb1l UTSW 18 10,509,314 (GRCm39) missense probably damaging 1.00
R1897:Greb1l UTSW 18 10,498,992 (GRCm39) missense probably benign 0.00
R1967:Greb1l UTSW 18 10,501,049 (GRCm39) missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10,515,221 (GRCm39) missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10,523,281 (GRCm39) missense probably damaging 1.00
R2125:Greb1l UTSW 18 10,511,422 (GRCm39) missense probably damaging 0.98
R2139:Greb1l UTSW 18 10,555,011 (GRCm39) missense probably damaging 1.00
R2255:Greb1l UTSW 18 10,554,857 (GRCm39) missense probably damaging 1.00
R2256:Greb1l UTSW 18 10,503,307 (GRCm39) missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10,503,307 (GRCm39) missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10,547,288 (GRCm39) missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10,542,380 (GRCm39) missense probably damaging 0.99
R3778:Greb1l UTSW 18 10,469,444 (GRCm39) missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10,522,247 (GRCm39) missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10,515,209 (GRCm39) missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10,522,150 (GRCm39) missense probably damaging 0.99
R4134:Greb1l UTSW 18 10,529,708 (GRCm39) critical splice donor site probably null
R4342:Greb1l UTSW 18 10,544,561 (GRCm39) missense probably benign 0.12
R4409:Greb1l UTSW 18 10,503,182 (GRCm39) missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10,553,705 (GRCm39) missense probably damaging 1.00
R4618:Greb1l UTSW 18 10,498,965 (GRCm39) missense probably benign 0.00
R4683:Greb1l UTSW 18 10,529,563 (GRCm39) splice site probably null
R4686:Greb1l UTSW 18 10,522,112 (GRCm39) missense probably damaging 0.98
R4707:Greb1l UTSW 18 10,532,922 (GRCm39) missense probably benign 0.02
R4780:Greb1l UTSW 18 10,541,792 (GRCm39) missense probably benign 0.00
R4819:Greb1l UTSW 18 10,458,358 (GRCm39) missense probably damaging 1.00
R4925:Greb1l UTSW 18 10,547,447 (GRCm39) missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10,547,306 (GRCm39) missense probably damaging 0.99
R5150:Greb1l UTSW 18 10,555,950 (GRCm39) frame shift probably null
R5154:Greb1l UTSW 18 10,458,312 (GRCm39) missense probably benign 0.02
R5269:Greb1l UTSW 18 10,511,409 (GRCm39) missense probably benign
R5290:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5310:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5328:Greb1l UTSW 18 10,553,720 (GRCm39) missense probably damaging 1.00
R5337:Greb1l UTSW 18 10,509,143 (GRCm39) missense probably damaging 1.00
R5402:Greb1l UTSW 18 10,537,169 (GRCm39) missense probably benign 0.26
R5718:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5719:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5720:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5721:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5902:Greb1l UTSW 18 10,538,302 (GRCm39) missense probably benign 0.00
R5993:Greb1l UTSW 18 10,544,455 (GRCm39) missense probably benign 0.10
R6035:Greb1l UTSW 18 10,501,025 (GRCm39) missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10,501,025 (GRCm39) missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10,547,068 (GRCm39) missense probably damaging 1.00
R6063:Greb1l UTSW 18 10,557,340 (GRCm39) missense probably damaging 1.00
R6297:Greb1l UTSW 18 10,469,494 (GRCm39) missense probably damaging 1.00
R6405:Greb1l UTSW 18 10,501,076 (GRCm39) missense probably benign 0.30
R6552:Greb1l UTSW 18 10,541,814 (GRCm39) missense probably benign 0.00
R6572:Greb1l UTSW 18 10,522,131 (GRCm39) missense probably benign 0.07
R6575:Greb1l UTSW 18 10,547,347 (GRCm39) missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10,547,482 (GRCm39) missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10,558,786 (GRCm39) missense probably benign 0.23
R6962:Greb1l UTSW 18 10,547,327 (GRCm39) missense probably damaging 1.00
R7012:Greb1l UTSW 18 10,529,707 (GRCm39) critical splice donor site probably null
R7179:Greb1l UTSW 18 10,544,576 (GRCm39) missense probably benign 0.00
R7251:Greb1l UTSW 18 10,515,319 (GRCm39) missense probably damaging 1.00
R7275:Greb1l UTSW 18 10,544,561 (GRCm39) missense probably benign 0.12
R7301:Greb1l UTSW 18 10,544,970 (GRCm39) missense probably damaging 1.00
R7307:Greb1l UTSW 18 10,538,142 (GRCm39) missense probably damaging 0.99
R7455:Greb1l UTSW 18 10,554,915 (GRCm39) missense probably damaging 1.00
R7832:Greb1l UTSW 18 10,542,056 (GRCm39) missense probably benign 0.38
R7934:Greb1l UTSW 18 10,474,371 (GRCm39) nonsense probably null
R8137:Greb1l UTSW 18 10,474,357 (GRCm39) missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10,533,060 (GRCm39) missense probably benign 0.13
R8208:Greb1l UTSW 18 10,510,703 (GRCm39) missense probably damaging 1.00
R8227:Greb1l UTSW 18 10,515,371 (GRCm39) missense probably damaging 1.00
R8312:Greb1l UTSW 18 10,511,587 (GRCm39) intron probably benign
R8331:Greb1l UTSW 18 10,458,706 (GRCm39) missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10,529,687 (GRCm39) missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10,529,613 (GRCm39) missense probably benign 0.00
R8695:Greb1l UTSW 18 10,544,450 (GRCm39) missense probably benign 0.01
R8795:Greb1l UTSW 18 10,553,739 (GRCm39) missense probably damaging 0.98
R8836:Greb1l UTSW 18 10,509,257 (GRCm39) missense probably benign 0.30
R8862:Greb1l UTSW 18 10,555,042 (GRCm39) missense possibly damaging 0.90
R8872:Greb1l UTSW 18 10,529,684 (GRCm39) missense probably benign 0.18
R8874:Greb1l UTSW 18 10,544,896 (GRCm39) missense probably benign 0.01
R8886:Greb1l UTSW 18 10,553,843 (GRCm39) missense probably benign 0.21
R8921:Greb1l UTSW 18 10,541,825 (GRCm39) missense probably benign 0.01
R8997:Greb1l UTSW 18 10,510,747 (GRCm39) missense probably damaging 1.00
R9015:Greb1l UTSW 18 10,541,675 (GRCm39) missense probably benign 0.00
R9018:Greb1l UTSW 18 10,542,004 (GRCm39) missense possibly damaging 0.76
R9074:Greb1l UTSW 18 10,558,795 (GRCm39) missense probably damaging 1.00
R9074:Greb1l UTSW 18 10,532,797 (GRCm39) missense probably damaging 1.00
R9117:Greb1l UTSW 18 10,542,422 (GRCm39) missense probably benign 0.31
R9189:Greb1l UTSW 18 10,499,983 (GRCm39) missense probably benign
R9332:Greb1l UTSW 18 10,532,796 (GRCm39) missense possibly damaging 0.92
R9367:Greb1l UTSW 18 10,522,130 (GRCm39) missense probably benign 0.00
R9497:Greb1l UTSW 18 10,458,600 (GRCm39) missense probably benign 0.00
R9796:Greb1l UTSW 18 10,538,233 (GRCm39) missense possibly damaging 0.69
Z1176:Greb1l UTSW 18 10,515,305 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTCTACTGATCATGGGCAGG -3'
(R):5'- CTGTTTAAACGAGGAAACCAATGC -3'

Sequencing Primer
(F):5'- GTTTTCAGAAGAGGTCCAGATCCC -3'
(R):5'- CTGAAAGATAACTTTGAGGAGGGG -3'
Posted On 2016-08-04