Incidental Mutation 'R5394:Hecw1'
ID426072
Institutional Source Beutler Lab
Gene Symbol Hecw1
Ensembl Gene ENSMUSG00000021301
Gene NameHECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
SynonymsE130207I19Rik, NEDL1
MMRRC Submission 042966-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5394 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location14226438-14523228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14322589 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 278 (V278E)
Ref Sequence ENSEMBL: ENSMUSP00000106145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110516]
Predicted Effect probably damaging
Transcript: ENSMUST00000110516
AA Change: V278E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106145
Gene: ENSMUSG00000021301
AA Change: V278E

DomainStartEndE-ValueType
Pfam:HECW_N 65 184 6.5e-62 PFAM
C2 206 317 1.02e-12 SMART
low complexity region 463 477 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
low complexity region 577 598 N/A INTRINSIC
low complexity region 677 704 N/A INTRINSIC
low complexity region 731 745 N/A INTRINSIC
WW 827 859 8.66e-13 SMART
coiled coil region 873 898 N/A INTRINSIC
low complexity region 917 930 N/A INTRINSIC
WW 1017 1049 5.59e-7 SMART
Blast:HECTc 1137 1192 3e-26 BLAST
low complexity region 1193 1208 N/A INTRINSIC
low complexity region 1212 1223 N/A INTRINSIC
HECTc 1267 1604 1.36e-185 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222241
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223317
Meta Mutation Damage Score 0.4319 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 97% (96/99)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,868,698 E226G probably damaging Het
4930503B20Rik A G 3: 146,650,608 F182L probably damaging Het
4930503B20Rik T C 3: 146,650,958 Y65C probably damaging Het
4930590J08Rik A G 6: 91,919,193 T341A probably benign Het
4932438A13Rik G T 3: 36,917,668 V517F probably damaging Het
Adamts13 G A 2: 26,986,558 V495I probably benign Het
Alms1 C A 6: 85,623,088 T2101K probably benign Het
Als2 T C 1: 59,174,946 D1361G probably benign Het
Ankdd1a A T 9: 65,505,214 M275K probably benign Het
Arfip2 A T 7: 105,636,976 Y161* probably null Het
Asap3 A T 4: 136,241,259 E707D probably benign Het
Atm C T 9: 53,507,777 probably null Het
Atp9b A T 18: 80,776,837 S577R probably benign Het
Camk1d G C 2: 5,303,366 D274E probably benign Het
Cebpz C T 17: 78,922,205 D907N probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cnst T A 1: 179,601,736 probably benign Het
Cog2 G T 8: 124,532,529 V196L probably benign Het
Col11a1 A G 3: 114,194,184 probably null Het
Cops6 T A 5: 138,163,500 probably null Het
Cspg4 A G 9: 56,890,200 E1316G probably damaging Het
Cwc22 G C 2: 77,929,339 D122E possibly damaging Het
Dapk2 G A 9: 66,268,718 V300M probably benign Het
Dcp1b C A 6: 119,175,367 D25E probably damaging Het
Ddx10 A T 9: 53,233,857 Y273* probably null Het
Dhx58 T C 11: 100,698,208 E504G probably benign Het
Dync2h1 C T 9: 7,120,899 W2129* probably null Het
Egr4 A T 6: 85,512,460 L206Q probably damaging Het
Eif4g3 A G 4: 138,103,398 probably null Het
Fbxo46 A G 7: 19,136,616 N387D possibly damaging Het
Fpr-rs3 T G 17: 20,624,208 M224L probably benign Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gxylt2 A G 6: 100,705,114 K91E probably benign Het
H2afy2 G A 10: 61,751,687 T156M possibly damaging Het
Hydin A G 8: 110,539,842 probably null Het
Iars T C 13: 49,722,165 L776P probably damaging Het
Kcnh2 T A 5: 24,332,041 T182S probably benign Het
Lats2 T G 14: 57,691,353 S1022R probably benign Het
Lef1 C T 3: 131,194,659 P264S probably damaging Het
Lyrm1 A C 7: 119,914,248 I79L possibly damaging Het
Man2b2 T G 5: 36,814,518 Q618P probably benign Het
Mei1 T C 15: 82,092,756 V180A possibly damaging Het
Mmp15 A T 8: 95,366,404 N137I probably damaging Het
Mms22l A G 4: 24,517,115 D222G possibly damaging Het
Mut T A 17: 40,947,184 S414T probably benign Het
Myo18a T C 11: 77,853,350 M1846T probably benign Het
Neo1 A T 9: 58,990,234 N146K probably benign Het
Nos3 A G 5: 24,383,890 T1174A probably benign Het
Olfr1233 A T 2: 89,339,462 I280N probably damaging Het
Olfr417 T C 1: 174,369,270 Y118H probably damaging Het
Olfr566 A T 7: 102,856,479 S268T probably damaging Het
Olfr960 A T 9: 39,623,134 T4S probably benign Het
Pax8 A T 2: 24,442,910 probably benign Het
Pde5a G A 3: 122,818,009 C532Y probably damaging Het
Pigq T C 17: 25,931,472 D442G possibly damaging Het
Pik3c2g T C 6: 139,720,082 V43A probably benign Het
Pik3cb T C 9: 99,088,663 N325S probably benign Het
Pot1b T C 17: 55,700,063 K18R probably benign Het
Ppp1r42 A T 1: 9,999,405 L144Q probably damaging Het
Prdm13 T A 4: 21,679,455 Q345L unknown Het
Pyroxd2 T A 19: 42,740,459 K167N probably benign Het
Rnf123 T C 9: 108,070,731 Y131C probably damaging Het
Rnf25 T C 1: 74,595,252 D204G probably damaging Het
Rpf2 G A 10: 40,233,185 T60I possibly damaging Het
Scaf11 T C 15: 96,419,458 N742D probably benign Het
Shank1 G A 7: 44,352,651 D1257N possibly damaging Het
Shc2 A G 10: 79,630,099 V168A probably damaging Het
Slc16a4 G A 3: 107,292,442 V2M probably benign Het
Slc24a3 T C 2: 145,613,574 V461A probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slc4a4 T A 5: 89,197,764 probably null Het
Snx30 T A 4: 59,879,329 D189E probably benign Het
Sspo A G 6: 48,495,260 Q4653R possibly damaging Het
Tpte G T 8: 22,327,790 R264I probably damaging Het
Tsc22d4 T A 5: 137,758,774 probably benign Het
Ubn1 T C 16: 5,074,369 L585P possibly damaging Het
Usp24 A T 4: 106,408,013 D1781V probably damaging Het
Utp20 A T 10: 88,772,915 Y1514* probably null Het
Vmn1r55 A T 7: 5,146,996 Y143N probably damaging Het
Vmn2r65 A G 7: 84,946,654 V274A probably benign Het
Wdr17 A G 8: 54,639,489 S1087P possibly damaging Het
Wnt5b C A 6: 119,440,322 R156L probably damaging Het
Zan T C 5: 137,435,634 D2279G unknown Het
Zan T C 5: 137,464,074 T948A unknown Het
Zfp758 T C 17: 22,372,068 S4P probably damaging Het
Zfp839 A G 12: 110,855,586 E278G probably benign Het
Zfp994 T A 17: 22,200,525 H481L probably damaging Het
Zswim9 G A 7: 13,260,983 R416C probably damaging Het
Other mutations in Hecw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Hecw1 APN 13 14265980 missense possibly damaging 0.71
IGL00813:Hecw1 APN 13 14278376 critical splice acceptor site probably null
IGL00843:Hecw1 APN 13 14247573 missense probably benign 0.02
IGL00942:Hecw1 APN 13 14340740 splice site probably benign
IGL00976:Hecw1 APN 13 14318972 missense probably damaging 1.00
IGL01289:Hecw1 APN 13 14264134 missense probably damaging 1.00
IGL01675:Hecw1 APN 13 14234422 missense probably damaging 1.00
IGL01783:Hecw1 APN 13 14278293 missense probably damaging 1.00
IGL01941:Hecw1 APN 13 14316310 missense probably benign 0.01
IGL02170:Hecw1 APN 13 14264158 missense possibly damaging 0.75
IGL02172:Hecw1 APN 13 14264149 missense probably damaging 1.00
IGL02214:Hecw1 APN 13 14300393 missense probably damaging 1.00
IGL02350:Hecw1 APN 13 14248338 splice site probably null
IGL02357:Hecw1 APN 13 14248338 splice site probably null
IGL02372:Hecw1 APN 13 14264121 missense probably damaging 1.00
IGL02591:Hecw1 APN 13 14357236 splice site probably benign
IGL02718:Hecw1 APN 13 14306935 critical splice acceptor site probably null
IGL02795:Hecw1 APN 13 14322517 missense probably damaging 1.00
IGL02941:Hecw1 APN 13 14377726 missense probably damaging 1.00
IGL03256:Hecw1 APN 13 14280484 missense probably damaging 0.99
IGL03256:Hecw1 APN 13 14280485 missense probably benign 0.36
IGL03366:Hecw1 APN 13 14377797 missense probably damaging 1.00
deflated UTSW 13 14247620 missense possibly damaging 0.69
Demoralized UTSW 13 14316818 nonsense probably null
Letdown UTSW 13 14316492 missense probably benign 0.40
BB001:Hecw1 UTSW 13 14322528 missense probably damaging 1.00
BB011:Hecw1 UTSW 13 14322528 missense probably damaging 1.00
IGL03014:Hecw1 UTSW 13 14245808 missense probably damaging 1.00
PIT4378001:Hecw1 UTSW 13 14377783 missense probably damaging 0.98
R0555:Hecw1 UTSW 13 14236941 missense probably damaging 1.00
R0617:Hecw1 UTSW 13 14280442 missense probably benign 0.44
R1476:Hecw1 UTSW 13 14306086 missense probably damaging 1.00
R1479:Hecw1 UTSW 13 14316492 missense probably benign 0.40
R1551:Hecw1 UTSW 13 14316943 missense probably damaging 1.00
R1579:Hecw1 UTSW 13 14377907 missense probably damaging 1.00
R1584:Hecw1 UTSW 13 14340743 critical splice donor site probably null
R1735:Hecw1 UTSW 13 14377765 missense probably null 0.09
R1872:Hecw1 UTSW 13 14280449 nonsense probably null
R1897:Hecw1 UTSW 13 14377940 missense probably damaging 1.00
R2054:Hecw1 UTSW 13 14297413 missense probably damaging 0.97
R2085:Hecw1 UTSW 13 14264087 missense possibly damaging 0.93
R2134:Hecw1 UTSW 13 14377700 missense probably damaging 1.00
R2172:Hecw1 UTSW 13 14377706 missense probably damaging 1.00
R2258:Hecw1 UTSW 13 14316138 missense probably benign 0.01
R2274:Hecw1 UTSW 13 14346068 missense probably benign 0.00
R2275:Hecw1 UTSW 13 14346068 missense probably benign 0.00
R2937:Hecw1 UTSW 13 14245836 missense possibly damaging 0.93
R3830:Hecw1 UTSW 13 14346058 missense probably benign 0.13
R3971:Hecw1 UTSW 13 14236929 missense probably damaging 1.00
R4065:Hecw1 UTSW 13 14316431 missense probably damaging 1.00
R4066:Hecw1 UTSW 13 14316431 missense probably damaging 1.00
R4235:Hecw1 UTSW 13 14317139 missense probably benign 0.42
R4366:Hecw1 UTSW 13 14316164 missense probably damaging 1.00
R4382:Hecw1 UTSW 13 14316164 missense probably damaging 1.00
R4385:Hecw1 UTSW 13 14316164 missense probably damaging 1.00
R4510:Hecw1 UTSW 13 14357191 missense probably damaging 1.00
R4511:Hecw1 UTSW 13 14357191 missense probably damaging 1.00
R4558:Hecw1 UTSW 13 14247605 missense probably damaging 0.99
R4804:Hecw1 UTSW 13 14305985 missense probably benign 0.00
R4854:Hecw1 UTSW 13 14316892 missense probably benign 0.00
R5104:Hecw1 UTSW 13 14340792 missense probably damaging 1.00
R5113:Hecw1 UTSW 13 14346029 missense possibly damaging 0.94
R5167:Hecw1 UTSW 13 14285657 missense probably damaging 1.00
R5392:Hecw1 UTSW 13 14245762 missense probably damaging 1.00
R5504:Hecw1 UTSW 13 14340902 missense probably benign 0.04
R5764:Hecw1 UTSW 13 14322509 missense probably damaging 1.00
R6038:Hecw1 UTSW 13 14346062 missense probably benign 0.28
R6038:Hecw1 UTSW 13 14346062 missense probably benign 0.28
R6228:Hecw1 UTSW 13 14346038 missense probably damaging 1.00
R6247:Hecw1 UTSW 13 14234425 nonsense probably null
R6252:Hecw1 UTSW 13 14272079 missense probably damaging 0.98
R6291:Hecw1 UTSW 13 14523007 unclassified probably benign
R6321:Hecw1 UTSW 13 14522829 missense probably benign 0.00
R6325:Hecw1 UTSW 13 14316446 missense probably damaging 1.00
R6328:Hecw1 UTSW 13 14247620 missense possibly damaging 0.69
R6557:Hecw1 UTSW 13 14316646 missense possibly damaging 0.78
R6566:Hecw1 UTSW 13 14297283 missense probably damaging 1.00
R6597:Hecw1 UTSW 13 14316818 nonsense probably null
R6821:Hecw1 UTSW 13 14264134 missense probably damaging 1.00
R6914:Hecw1 UTSW 13 14316838 missense probably damaging 0.99
R7078:Hecw1 UTSW 13 14434459 start codon destroyed probably null 0.21
R7114:Hecw1 UTSW 13 14311771 missense probably benign 0.02
R7140:Hecw1 UTSW 13 14316533 missense probably benign
R7150:Hecw1 UTSW 13 14434460 start codon destroyed probably benign
R7288:Hecw1 UTSW 13 14316236 missense probably benign 0.00
R7447:Hecw1 UTSW 13 14357204 missense probably damaging 1.00
R7479:Hecw1 UTSW 13 14340840 missense probably damaging 1.00
R7552:Hecw1 UTSW 13 14316250 missense probably damaging 0.99
R7590:Hecw1 UTSW 13 14264083 missense probably damaging 1.00
R7787:Hecw1 UTSW 13 14318909 missense probably damaging 1.00
R7803:Hecw1 UTSW 13 14234342 missense probably benign 0.25
R7924:Hecw1 UTSW 13 14322528 missense probably damaging 1.00
R7967:Hecw1 UTSW 13 14377747 missense probably damaging 1.00
R8176:Hecw1 UTSW 13 14247701 splice site probably null
R8195:Hecw1 UTSW 13 14306107 missense probably damaging 0.99
R8252:Hecw1 UTSW 13 14340840 missense probably damaging 1.00
R8696:Hecw1 UTSW 13 14357158 missense possibly damaging 0.93
R8827:Hecw1 UTSW 13 14264135 missense probably damaging 1.00
R8867:Hecw1 UTSW 13 14247690 critical splice acceptor site probably null
R8914:Hecw1 UTSW 13 14247603 missense probably damaging 1.00
R8942:Hecw1 UTSW 13 14306810 missense probably benign 0.28
RF001:Hecw1 UTSW 13 14297424 missense probably damaging 1.00
X0020:Hecw1 UTSW 13 14230723 missense possibly damaging 0.52
X0066:Hecw1 UTSW 13 14280460 missense probably benign 0.13
Z1176:Hecw1 UTSW 13 14300333 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TCCAGGAAATGATATTGGTGGG -3'
(R):5'- CTAAAGGAGCATGCAGTTGTC -3'

Sequencing Primer
(F):5'- CCATCAGACTTTGTAATGGCAGC -3'
(R):5'- AGGAGCATGCAGTTGTCATCCC -3'
Posted On2016-08-04