Incidental Mutation 'R5395:Olfr1406'
ID426093
Institutional Source Beutler Lab
Gene Symbol Olfr1406
Ensembl Gene ENSMUSG00000058981
Gene Nameolfactory receptor 1406
SynonymsMOR267-5, GA_x6K02T2R7CC-664297-665229
MMRRC Submission 042967-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R5395 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location173181853-173190640 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 173183680 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 251 (Y251*)
Ref Sequence ENSEMBL: ENSMUSP00000151023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072395] [ENSMUST00000201132] [ENSMUST00000215878]
Predicted Effect probably null
Transcript: ENSMUST00000072395
AA Change: Y251*
SMART Domains Protein: ENSMUSP00000072231
Gene: ENSMUSG00000058981
AA Change: Y251*

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.9e-55 PFAM
Pfam:7tm_1 41 289 2.7e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000201132
AA Change: Y251*
SMART Domains Protein: ENSMUSP00000144530
Gene: ENSMUSG00000058981
AA Change: Y251*

DomainStartEndE-ValueType
Pfam:7tm_4 31 88 5.4e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000215878
AA Change: Y251*
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,080,941 I268V probably benign Het
Actn1 T A 12: 80,170,703 I782F probably benign Het
Adamdec1 A C 14: 68,570,903 S333A probably benign Het
Agbl5 C A 5: 30,890,338 T58N probably damaging Het
Apoo-ps T A 13: 107,414,493 noncoding transcript Het
Arhgef10l T C 4: 140,570,290 N277S probably benign Het
Ascc2 A G 11: 4,659,273 E241G possibly damaging Het
Atp13a4 A T 16: 29,420,888 Y835* probably null Het
Atp13a4 A G 16: 29,456,604 V354A possibly damaging Het
Bcas3 T C 11: 85,825,249 S426P probably damaging Het
Birc3 T C 9: 7,861,174 R48G probably damaging Het
Cacna2d4 T C 6: 119,271,418 S397P possibly damaging Het
Ccng2 T C 5: 93,269,398 M91T possibly damaging Het
Clk3 G A 9: 57,753,339 T473M probably damaging Het
Cog2 T A 8: 124,545,221 H491Q probably benign Het
Cyp4f40 C T 17: 32,669,853 T202I probably benign Het
Dennd1a A T 2: 37,802,128 F181I probably damaging Het
Fcrl6 G T 1: 172,598,720 A170D possibly damaging Het
Fev T C 1: 74,882,664 probably null Het
Flnb A G 14: 7,883,881 N369S probably benign Het
Flt3 A G 5: 147,354,823 F606L probably damaging Het
Gdf9 T C 11: 53,433,797 V131A probably benign Het
Gdnf T A 15: 7,834,684 L192Q probably damaging Het
Gjc2 A T 11: 59,177,489 C56S possibly damaging Het
Gli3 T C 13: 15,714,950 F550L probably damaging Het
Gm1110 T C 9: 26,889,632 E422G probably benign Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gnb2 A G 5: 137,528,526 S334P probably damaging Het
Icam2 A T 11: 106,382,473 probably null Het
Inca1 C T 11: 70,690,438 probably null Het
Itgb8 A C 12: 119,170,741 C530W probably damaging Het
Lrp1 T C 10: 127,595,297 D332G probably damaging Het
Ly75 A T 2: 60,365,111 N234K probably benign Het
Mcm5 G A 8: 75,123,026 S542N probably benign Het
Mcm9 A T 10: 53,538,692 N97K possibly damaging Het
Morc2a G A 11: 3,688,232 R986H possibly damaging Het
Neu2 T A 1: 87,596,675 probably null Het
Nfatc1 G A 18: 80,636,020 P718S possibly damaging Het
Nol6 G A 4: 41,118,392 probably benign Het
Otogl T C 10: 107,817,138 N1118D probably benign Het
Pcdh15 T A 10: 74,185,287 I111K probably damaging Het
Phkb A G 8: 86,017,468 D582G probably damaging Het
Piwil2 G T 14: 70,395,397 N575K probably benign Het
Pou4f2 T A 8: 78,435,072 I301F probably damaging Het
Prkd1 T C 12: 50,391,432 N409S probably damaging Het
Ptpn21 T G 12: 98,715,117 K86T probably damaging Het
Raly T A 2: 154,864,007 probably null Het
Rangap1 A G 15: 81,706,446 F482L probably benign Het
Rapgef1 T A 2: 29,737,965 N1052K probably damaging Het
Rnf169 A T 7: 99,935,160 probably null Het
Sdr16c5 T C 4: 4,016,277 S50G probably benign Het
Sin3a G A 9: 57,105,673 R612H probably damaging Het
Six6 T A 12: 72,941,701 L216* probably null Het
Slc20a1 A T 2: 129,208,337 N472Y probably damaging Het
Slc35d1 C T 4: 103,211,375 probably null Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slc7a8 C A 14: 54,733,277 G306* probably null Het
Slc9a8 T A 2: 167,467,722 F335L probably damaging Het
Smyd1 T G 6: 71,219,390 K338T possibly damaging Het
Snd1 T A 6: 28,526,184 V187E probably damaging Het
Spag9 T G 11: 94,091,751 probably null Het
Tnfsf9 C A 17: 57,105,592 T54K probably benign Het
Trim24 T G 6: 37,957,744 V798G probably damaging Het
Tyr C A 7: 87,472,490 A365S probably damaging Het
Usp43 T A 11: 67,897,358 probably null Het
Vmn2r55 T C 7: 12,651,947 D702G probably damaging Het
Vmn2r72 A G 7: 85,750,897 S315P possibly damaging Het
Wdr64 T A 1: 175,755,598 F367I probably damaging Het
Zc3h7b G A 15: 81,772,501 R173K possibly damaging Het
Zfp493 T A 13: 67,783,846 C21* probably null Het
Zfp825 T C 13: 74,480,546 T284A possibly damaging Het
Zpbp2 T A 11: 98,558,213 V275D probably damaging Het
Other mutations in Olfr1406
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Olfr1406 APN 1 173183623 missense probably benign 0.45
IGL01609:Olfr1406 APN 1 173184276 missense probably benign 0.00
IGL01996:Olfr1406 APN 1 173183727 missense probably benign 0.00
F5770:Olfr1406 UTSW 1 173183964 missense probably benign 0.05
PIT4378001:Olfr1406 UTSW 1 173183814 missense probably benign 0.00
R0053:Olfr1406 UTSW 1 173184278 missense probably benign 0.35
R0800:Olfr1406 UTSW 1 173184060 missense probably damaging 1.00
R1793:Olfr1406 UTSW 1 173184409 missense probably benign
R2230:Olfr1406 UTSW 1 173183615 missense probably benign 0.04
R2232:Olfr1406 UTSW 1 173183615 missense probably benign 0.04
R5455:Olfr1406 UTSW 1 173184251 missense probably damaging 1.00
R5457:Olfr1406 UTSW 1 173183613 missense probably damaging 1.00
R5558:Olfr1406 UTSW 1 173184018 missense probably benign 0.01
R5760:Olfr1406 UTSW 1 173183751 missense probably benign 0.05
R6285:Olfr1406 UTSW 1 173183910 missense probably damaging 1.00
R7159:Olfr1406 UTSW 1 173184323 missense possibly damaging 0.95
R7676:Olfr1406 UTSW 1 173183553 nonsense probably null
R8700:Olfr1406 UTSW 1 173183862 missense probably benign
R8829:Olfr1406 UTSW 1 173183891 missense probably benign 0.06
V7580:Olfr1406 UTSW 1 173183964 missense probably benign 0.05
V7581:Olfr1406 UTSW 1 173183964 missense probably benign 0.05
V7582:Olfr1406 UTSW 1 173183964 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCCCTATCAGGTTCCATGTG -3'
(R):5'- GCCAGTCATCAATGATATCTTGACG -3'

Sequencing Primer
(F):5'- GCCCTATCAGGTTCCATGTGAAAAAG -3'
(R):5'- GATATCTTGACGTTAGCTCTTAGC -3'
Posted On2016-08-04