Incidental Mutation 'R0494:Strc'
ID42611
Institutional Source Beutler Lab
Gene Symbol Strc
Ensembl Gene ENSMUSG00000033498
Gene Namestereocilin
SynonymsDFNB16
MMRRC Submission 038691-MU
Accession Numbers

Genbank: NM_080459; MGI: 2153816

Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R0494 (G1)
Quality Score206
Status Validated
Chromosome2
Chromosomal Location121363728-121387168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121379533 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 103 (D103G)
Ref Sequence ENSEMBL: ENSMUSP00000039378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038389] [ENSMUST00000129136]
Predicted Effect probably damaging
Transcript: ENSMUST00000038389
AA Change: D103G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: D103G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 74 87 N/A INTRINSIC
low complexity region 108 119 N/A INTRINSIC
low complexity region 132 161 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
low complexity region 376 425 N/A INTRINSIC
low complexity region 610 635 N/A INTRINSIC
low complexity region 656 677 N/A INTRINSIC
low complexity region 728 746 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1168 1194 N/A INTRINSIC
low complexity region 1287 1302 N/A INTRINSIC
low complexity region 1560 1580 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129136
SMART Domains Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498

DomainStartEndE-ValueType
low complexity region 26 49 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150332
Meta Mutation Damage Score 0.0853 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 97% (109/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik G A 5: 9,420,723 probably null Het
Aatf T C 11: 84,511,513 I116V probably benign Het
Abhd18 T C 3: 40,916,688 F94S probably damaging Het
Adam28 T A 14: 68,630,792 probably benign Het
Amn1 A T 6: 149,185,136 probably benign Het
Arhgap32 T C 9: 32,258,903 V993A probably damaging Het
Arhgap33 A T 7: 30,524,496 S703T probably damaging Het
Arhgef1 T C 7: 24,919,360 probably benign Het
Atg2a A G 19: 6,253,377 Y1083C probably damaging Het
Atp2a3 T C 11: 72,981,905 F760L probably damaging Het
B9d1 A G 11: 61,512,445 probably benign Het
Batf C T 12: 85,686,862 probably benign Het
BC051019 T A 7: 109,717,975 Y170F probably benign Het
Bphl T C 13: 34,037,771 *37Q probably null Het
Cab39l T C 14: 59,499,559 S43P probably damaging Het
Cad A G 5: 31,077,512 probably benign Het
Cct4 T G 11: 22,996,014 S119A probably benign Het
Cd163 G A 6: 124,311,449 V280M probably damaging Het
Cd86 A G 16: 36,618,637 probably benign Het
Cdh23 G A 10: 60,316,596 probably benign Het
Cdhr5 A G 7: 141,272,518 F145S probably damaging Het
Cdt1 T C 8: 122,572,060 S479P possibly damaging Het
Ces2g T C 8: 104,966,567 V372A probably benign Het
Chrna3 T C 9: 55,022,278 D92G probably damaging Het
Cndp1 A G 18: 84,619,533 S359P probably benign Het
Cops4 A G 5: 100,528,662 Q93R probably damaging Het
Dgka G C 10: 128,721,083 probably benign Het
Dmp1 A T 5: 104,212,208 D250V probably damaging Het
Dnajb2 C T 1: 75,239,634 probably benign Het
Dock9 T C 14: 121,662,584 T113A possibly damaging Het
Egln3 T A 12: 54,203,321 I81F probably benign Het
Elovl5 T C 9: 77,960,917 V37A probably benign Het
Esco1 A T 18: 10,594,940 N115K probably benign Het
Fat1 A T 8: 44,950,542 N110I probably damaging Het
Fezf1 T A 6: 23,246,055 K370N probably damaging Het
Galnt18 T A 7: 111,554,564 K284N probably damaging Het
Glt8d1 C A 14: 31,011,623 T355K possibly damaging Het
Gm13083 G T 4: 143,616,156 V278F probably benign Het
Gm17455 G A 10: 60,403,235 R93H possibly damaging Het
Gng8 T A 7: 16,895,288 D46E probably benign Het
Gpx4 T C 10: 80,056,177 probably benign Het
Grk2 A T 19: 4,291,319 N189K probably damaging Het
Grm5 T C 7: 88,130,781 V1143A probably benign Het
Hibch A G 1: 52,902,896 E237G possibly damaging Het
Hipk2 C T 6: 38,729,989 A682T probably benign Het
Hmcn1 G T 1: 150,732,792 probably benign Het
Htt A G 5: 34,821,844 D857G possibly damaging Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Igsf8 A G 1: 172,318,698 E421G probably benign Het
Kif26a T A 12: 112,179,471 probably null Het
Klhl26 T C 8: 70,451,601 Y519C probably damaging Het
Lamc1 A C 1: 153,246,936 probably null Het
Mical3 A T 6: 120,959,201 S1455T possibly damaging Het
Mitf G A 6: 97,994,429 G186S probably benign Het
Ms4a15 G A 19: 10,981,358 probably benign Het
Myo5b A G 18: 74,653,967 E481G probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nbeal2 C A 9: 110,627,187 V1686L probably damaging Het
Nedd4l T G 18: 65,173,021 S335A possibly damaging Het
Nos1 A T 5: 117,905,474 N605Y probably damaging Het
Nyx C A X: 13,487,269 T454K probably benign Het
Olfr666 A G 7: 104,893,271 L119P probably damaging Het
Olfr972 T A 9: 39,873,402 N42K probably damaging Het
Pcdhb12 T A 18: 37,438,095 F765I probably benign Het
Pex3 C T 10: 13,527,788 G330R probably damaging Het
Pfkfb1 T C X: 150,634,613 Y339H probably damaging Het
Pias1 G A 9: 62,887,311 Q26* probably null Het
Pik3cg C A 12: 32,204,546 V481L possibly damaging Het
Plcg2 C T 8: 117,556,104 T108M probably damaging Het
Pon2 G A 6: 5,267,059 probably benign Het
Ppef2 A T 5: 92,253,093 probably benign Het
Ptpn22 A G 3: 103,860,455 K18E probably damaging Het
Pum2 C T 12: 8,721,736 Q360* probably null Het
Rab10 A C 12: 3,252,723 probably null Het
Ranbp2 T G 10: 58,467,432 S809A possibly damaging Het
Rbms2 A G 10: 128,133,670 V348A probably benign Het
Rnf213 A G 11: 119,426,012 E988G possibly damaging Het
Rnf213 A T 11: 119,443,120 M3052L probably damaging Het
Rpl14 C A 9: 120,574,362 probably benign Het
Rplp0 A G 5: 115,559,872 Y13C possibly damaging Het
Ryr1 A G 7: 29,003,793 probably benign Het
Sac3d1 T C 19: 6,118,294 E98G probably damaging Het
Scn10a T A 9: 119,624,100 D1242V probably damaging Het
Scnn1b T C 7: 121,899,458 Y74H probably damaging Het
Serpinb3a C T 1: 107,047,482 W198* probably null Het
Sf3b4 C A 3: 96,173,701 D108E probably damaging Het
Shprh T C 10: 11,157,191 V307A probably damaging Het
Slc2a2 A G 3: 28,727,277 D458G probably benign Het
Spata5 G C 3: 37,432,163 D345H possibly damaging Het
Synrg T C 11: 84,019,543 I923T probably benign Het
Tango6 G T 8: 106,735,682 probably benign Het
Tas2r106 A G 6: 131,678,576 L104P probably damaging Het
Tat C T 8: 109,991,684 P67L probably damaging Het
Tln2 A C 9: 67,355,197 S593A probably benign Het
Tmem94 A G 11: 115,794,781 probably null Het
Tppp3 G A 8: 105,468,172 A109V probably benign Het
Trank1 T C 9: 111,391,293 F2366S probably benign Het
Trpc5 T A X: 144,481,396 Y155F probably damaging Het
Trpv1 A G 11: 73,260,442 T451A probably benign Het
Ttc9 C A 12: 81,631,649 A82E probably damaging Het
Ttll11 T A 2: 35,944,874 N180I probably damaging Het
Ttn T C 2: 76,736,399 N28050S possibly damaging Het
Vmn2r73 G T 7: 85,872,932 H66Q probably benign Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Wnt3 G A 11: 103,812,315 C208Y probably damaging Het
Zfp521 C A 18: 13,845,268 C696F probably damaging Het
Zfp521 T C 18: 13,846,870 D162G probably damaging Het
Zfp869 A T 8: 69,706,404 H506Q probably damaging Het
Other mutations in Strc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Strc APN 2 121365060 missense probably benign 0.39
IGL01152:Strc APN 2 121370795 missense probably benign
IGL01608:Strc APN 2 121375594 missense probably benign 0.05
IGL01695:Strc APN 2 121375298 missense probably damaging 1.00
IGL01715:Strc APN 2 121365737 splice site probably null
IGL01906:Strc APN 2 121377634 missense probably benign
IGL02135:Strc APN 2 121364834 missense probably damaging 1.00
IGL02416:Strc APN 2 121369058 missense probably damaging 1.00
IGL02455:Strc APN 2 121375791 unclassified probably benign
IGL03029:Strc APN 2 121364044 missense possibly damaging 0.95
IGL03176:Strc APN 2 121372180 missense probably damaging 0.99
IGL03272:Strc APN 2 121371751 missense probably damaging 1.00
3-1:Strc UTSW 2 121373680 missense probably damaging 0.99
IGL02799:Strc UTSW 2 121379236 missense probably damaging 1.00
PIT4283001:Strc UTSW 2 121375307 missense probably damaging 1.00
R0022:Strc UTSW 2 121368393 missense probably damaging 1.00
R1065:Strc UTSW 2 121366651 missense probably damaging 1.00
R1148:Strc UTSW 2 121372077 intron probably benign
R1148:Strc UTSW 2 121372077 intron probably benign
R1203:Strc UTSW 2 121372123 missense possibly damaging 0.66
R1343:Strc UTSW 2 121365115 missense probably benign 0.21
R1544:Strc UTSW 2 121372738 splice site probably null
R1650:Strc UTSW 2 121380885 start gained probably benign
R1840:Strc UTSW 2 121379296 missense probably damaging 1.00
R1983:Strc UTSW 2 121371037 missense possibly damaging 0.54
R2035:Strc UTSW 2 121374934 missense probably damaging 1.00
R2058:Strc UTSW 2 121378887 missense probably damaging 1.00
R2158:Strc UTSW 2 121365862 missense probably benign 0.10
R2219:Strc UTSW 2 121364523 missense probably damaging 1.00
R2680:Strc UTSW 2 121365111 missense probably damaging 0.99
R4375:Strc UTSW 2 121380823 missense unknown
R4563:Strc UTSW 2 121365805 missense probably benign 0.02
R4578:Strc UTSW 2 121378003 missense possibly damaging 0.94
R4607:Strc UTSW 2 121372945 missense probably benign 0.31
R4651:Strc UTSW 2 121374348 missense possibly damaging 0.67
R4652:Strc UTSW 2 121374348 missense possibly damaging 0.67
R4790:Strc UTSW 2 121375594 missense probably benign 0.05
R5480:Strc UTSW 2 121364819 missense probably benign 0.00
R5580:Strc UTSW 2 121375012 missense probably damaging 0.99
R5679:Strc UTSW 2 121368100 missense probably benign 0.03
R5703:Strc UTSW 2 121370814 missense probably benign
R5841:Strc UTSW 2 121365877 missense probably benign 0.29
R5917:Strc UTSW 2 121379309 missense probably benign
R5958:Strc UTSW 2 121376922 missense possibly damaging 0.56
R6320:Strc UTSW 2 121374958 missense probably benign 0.16
R6619:Strc UTSW 2 121368432 missense probably damaging 0.99
R6695:Strc UTSW 2 121377224 missense probably benign 0.35
R6970:Strc UTSW 2 121378014 missense probably benign 0.41
R7018:Strc UTSW 2 121369058 missense probably damaging 1.00
R7045:Strc UTSW 2 121370726 missense probably damaging 1.00
R7190:Strc UTSW 2 121369026 missense probably benign 0.14
R7283:Strc UTSW 2 121379452 missense probably damaging 0.99
R7694:Strc UTSW 2 121377096 missense probably damaging 1.00
R7699:Strc UTSW 2 121371748 missense possibly damaging 0.47
R7700:Strc UTSW 2 121371748 missense possibly damaging 0.47
R7756:Strc UTSW 2 121370946 missense probably benign
R7758:Strc UTSW 2 121370946 missense probably benign
R7822:Strc UTSW 2 121377738 missense probably benign 0.01
R7830:Strc UTSW 2 121375049 missense probably damaging 0.99
R7953:Strc UTSW 2 121377363 missense probably damaging 0.99
R8137:Strc UTSW 2 121366738 missense probably damaging 0.98
R8394:Strc UTSW 2 121379009 missense probably benign 0.00
R8427:Strc UTSW 2 121377531 missense probably damaging 1.00
Z1176:Strc UTSW 2 121375521 missense probably damaging 0.98
Z1176:Strc UTSW 2 121379044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCCAGCGTGTACCCTCTAATAAC -3'
(R):5'- CATTCGTAGCCACTCTGGACCAAG -3'

Sequencing Primer
(F):5'- CAGTCAGAAGGGCCATCACG -3'
(R):5'- TGGACCAAGCTCCTCAGC -3'
Posted On2013-05-23