Incidental Mutation 'R5395:Gnb2'
ID426111
Institutional Source Beutler Lab
Gene Symbol Gnb2
Ensembl Gene ENSMUSG00000029713
Gene Nameguanine nucleotide binding protein (G protein), beta 2
Synonyms
MMRRC Submission 042967-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5395 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location137528127-137533510 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137528526 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 334 (S334P)
Ref Sequence ENSEMBL: ENSMUSP00000129353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031726] [ENSMUST00000031727] [ENSMUST00000111020] [ENSMUST00000111023] [ENSMUST00000111027] [ENSMUST00000111038] [ENSMUST00000132525] [ENSMUST00000140139] [ENSMUST00000143495] [ENSMUST00000150063] [ENSMUST00000170293] [ENSMUST00000168746]
Predicted Effect probably damaging
Transcript: ENSMUST00000031726
AA Change: S334P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031726
Gene: ENSMUSG00000029713
AA Change: S334P

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
WD40 44 83 1.05e-7 SMART
WD40 86 125 3.96e-3 SMART
WD40 132 170 1.57e-6 SMART
WD40 173 212 2.98e-7 SMART
WD40 215 254 2.1e-7 SMART
WD40 257 298 1.72e-3 SMART
WD40 301 340 2.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000031727
SMART Domains Protein: ENSMUSP00000031727
Gene: ENSMUSG00000029714

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
low complexity region 114 129 N/A INTRINSIC
low complexity region 253 269 N/A INTRINSIC
low complexity region 323 352 N/A INTRINSIC
low complexity region 360 379 N/A INTRINSIC
coiled coil region 424 450 N/A INTRINSIC
GYF 477 532 1.6e-25 SMART
low complexity region 534 543 N/A INTRINSIC
low complexity region 553 576 N/A INTRINSIC
low complexity region 597 613 N/A INTRINSIC
coiled coil region 671 735 N/A INTRINSIC
low complexity region 748 759 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
low complexity region 848 877 N/A INTRINSIC
low complexity region 881 893 N/A INTRINSIC
coiled coil region 957 984 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111020
AA Change: S290P

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106649
Gene: ENSMUSG00000029713
AA Change: S290P

DomainStartEndE-ValueType
WD40 1 39 2.65e-4 SMART
WD40 42 81 3.96e-3 SMART
WD40 88 126 1.57e-6 SMART
WD40 129 168 2.98e-7 SMART
WD40 171 210 2.1e-7 SMART
WD40 213 254 1.72e-3 SMART
WD40 257 296 2.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111023
AA Change: S290P

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106652
Gene: ENSMUSG00000029713
AA Change: S290P

DomainStartEndE-ValueType
WD40 1 39 2.65e-4 SMART
WD40 42 81 3.96e-3 SMART
WD40 88 126 1.57e-6 SMART
WD40 129 168 2.98e-7 SMART
WD40 171 210 2.1e-7 SMART
WD40 213 254 1.72e-3 SMART
WD40 257 296 2.04e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111027
AA Change: S376P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106656
Gene: ENSMUSG00000029713
AA Change: S376P

DomainStartEndE-ValueType
low complexity region 23 41 N/A INTRINSIC
low complexity region 45 59 N/A INTRINSIC
WD40 86 125 1.05e-7 SMART
WD40 128 167 3.96e-3 SMART
WD40 174 212 1.57e-6 SMART
WD40 215 254 2.98e-7 SMART
WD40 257 296 2.1e-7 SMART
WD40 299 340 1.72e-3 SMART
WD40 343 382 2.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111038
SMART Domains Protein: ENSMUSP00000106667
Gene: ENSMUSG00000029711

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:EPO_TPO 30 191 2.8e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125868
Predicted Effect probably benign
Transcript: ENSMUST00000132525
SMART Domains Protein: ENSMUSP00000119725
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
WD40 44 83 1.05e-7 SMART
WD40 86 125 3.96e-3 SMART
WD40 132 170 1.57e-6 SMART
WD40 173 212 2.98e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140139
SMART Domains Protein: ENSMUSP00000121942
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
WD40 44 83 1.05e-7 SMART
WD40 86 125 3.96e-3 SMART
WD40 132 170 1.57e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142252
Predicted Effect probably damaging
Transcript: ENSMUST00000143495
AA Change: S234P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126823
Gene: ENSMUSG00000029713
AA Change: S234P

DomainStartEndE-ValueType
Pfam:WD40 1 25 3.8e-3 PFAM
WD40 32 70 1.57e-6 SMART
WD40 73 112 2.98e-7 SMART
WD40 115 154 2.1e-7 SMART
WD40 157 198 1.72e-3 SMART
WD40 201 240 2.04e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144667
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145238
Predicted Effect probably damaging
Transcript: ENSMUST00000150063
AA Change: S334P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129353
Gene: ENSMUSG00000029713
AA Change: S334P

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
WD40 44 83 1.05e-7 SMART
WD40 86 125 3.96e-3 SMART
WD40 132 170 1.57e-6 SMART
WD40 173 212 2.98e-7 SMART
WD40 215 254 2.1e-7 SMART
WD40 257 298 1.72e-3 SMART
WD40 301 340 2.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170293
AA Change: S290P

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128038
Gene: ENSMUSG00000029713
AA Change: S290P

DomainStartEndE-ValueType
WD40 1 39 2.65e-4 SMART
WD40 42 81 3.96e-3 SMART
WD40 88 126 1.57e-6 SMART
WD40 129 168 2.98e-7 SMART
WD40 171 210 2.1e-7 SMART
WD40 213 254 1.72e-3 SMART
WD40 257 296 2.04e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167225
Predicted Effect probably damaging
Transcript: ENSMUST00000168746
AA Change: S234P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132908
Gene: ENSMUSG00000029713
AA Change: S234P

DomainStartEndE-ValueType
Pfam:WD40 1 25 3.8e-3 PFAM
WD40 32 70 1.57e-6 SMART
WD40 73 112 2.98e-7 SMART
WD40 115 154 2.1e-7 SMART
WD40 157 198 1.72e-3 SMART
WD40 201 240 2.04e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163194
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. This gene contains a trinucleotide (CCG) repeat length polymorphism in its 5' UTR. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,080,941 I268V probably benign Het
Actn1 T A 12: 80,170,703 I782F probably benign Het
Adamdec1 A C 14: 68,570,903 S333A probably benign Het
Agbl5 C A 5: 30,890,338 T58N probably damaging Het
Apoo-ps T A 13: 107,414,493 noncoding transcript Het
Arhgef10l T C 4: 140,570,290 N277S probably benign Het
Ascc2 A G 11: 4,659,273 E241G possibly damaging Het
Atp13a4 A T 16: 29,420,888 Y835* probably null Het
Atp13a4 A G 16: 29,456,604 V354A possibly damaging Het
Bcas3 T C 11: 85,825,249 S426P probably damaging Het
Birc3 T C 9: 7,861,174 R48G probably damaging Het
Cacna2d4 T C 6: 119,271,418 S397P possibly damaging Het
Ccng2 T C 5: 93,269,398 M91T possibly damaging Het
Clk3 G A 9: 57,753,339 T473M probably damaging Het
Cog2 T A 8: 124,545,221 H491Q probably benign Het
Cyp4f40 C T 17: 32,669,853 T202I probably benign Het
Dennd1a A T 2: 37,802,128 F181I probably damaging Het
Fcrl6 G T 1: 172,598,720 A170D possibly damaging Het
Fev T C 1: 74,882,664 probably null Het
Flnb A G 14: 7,883,881 N369S probably benign Het
Flt3 A G 5: 147,354,823 F606L probably damaging Het
Gdf9 T C 11: 53,433,797 V131A probably benign Het
Gdnf T A 15: 7,834,684 L192Q probably damaging Het
Gjc2 A T 11: 59,177,489 C56S possibly damaging Het
Gli3 T C 13: 15,714,950 F550L probably damaging Het
Gm1110 T C 9: 26,889,632 E422G probably benign Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Icam2 A T 11: 106,382,473 probably null Het
Inca1 C T 11: 70,690,438 probably null Het
Itgb8 A C 12: 119,170,741 C530W probably damaging Het
Lrp1 T C 10: 127,595,297 D332G probably damaging Het
Ly75 A T 2: 60,365,111 N234K probably benign Het
Mcm5 G A 8: 75,123,026 S542N probably benign Het
Mcm9 A T 10: 53,538,692 N97K possibly damaging Het
Morc2a G A 11: 3,688,232 R986H possibly damaging Het
Neu2 T A 1: 87,596,675 probably null Het
Nfatc1 G A 18: 80,636,020 P718S possibly damaging Het
Nol6 G A 4: 41,118,392 probably benign Het
Olfr1406 A T 1: 173,183,680 Y251* probably null Het
Otogl T C 10: 107,817,138 N1118D probably benign Het
Pcdh15 T A 10: 74,185,287 I111K probably damaging Het
Phkb A G 8: 86,017,468 D582G probably damaging Het
Piwil2 G T 14: 70,395,397 N575K probably benign Het
Pou4f2 T A 8: 78,435,072 I301F probably damaging Het
Prkd1 T C 12: 50,391,432 N409S probably damaging Het
Ptpn21 T G 12: 98,715,117 K86T probably damaging Het
Raly T A 2: 154,864,007 probably null Het
Rangap1 A G 15: 81,706,446 F482L probably benign Het
Rapgef1 T A 2: 29,737,965 N1052K probably damaging Het
Rnf169 A T 7: 99,935,160 probably null Het
Sdr16c5 T C 4: 4,016,277 S50G probably benign Het
Sin3a G A 9: 57,105,673 R612H probably damaging Het
Six6 T A 12: 72,941,701 L216* probably null Het
Slc20a1 A T 2: 129,208,337 N472Y probably damaging Het
Slc35d1 C T 4: 103,211,375 probably null Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slc7a8 C A 14: 54,733,277 G306* probably null Het
Slc9a8 T A 2: 167,467,722 F335L probably damaging Het
Smyd1 T G 6: 71,219,390 K338T possibly damaging Het
Snd1 T A 6: 28,526,184 V187E probably damaging Het
Spag9 T G 11: 94,091,751 probably null Het
Tnfsf9 C A 17: 57,105,592 T54K probably benign Het
Trim24 T G 6: 37,957,744 V798G probably damaging Het
Tyr C A 7: 87,472,490 A365S probably damaging Het
Usp43 T A 11: 67,897,358 probably null Het
Vmn2r55 T C 7: 12,651,947 D702G probably damaging Het
Vmn2r72 A G 7: 85,750,897 S315P possibly damaging Het
Wdr64 T A 1: 175,755,598 F367I probably damaging Het
Zc3h7b G A 15: 81,772,501 R173K possibly damaging Het
Zfp493 T A 13: 67,783,846 C21* probably null Het
Zfp825 T C 13: 74,480,546 T284A possibly damaging Het
Zpbp2 T A 11: 98,558,213 V275D probably damaging Het
Other mutations in Gnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Gnb2 APN 5 137530706 intron probably benign
ruffian UTSW 5 137530182 critical splice donor site probably null
R2336:Gnb2 UTSW 5 137529198 missense probably damaging 1.00
R4661:Gnb2 UTSW 5 137530253 start codon destroyed probably null 0.30
R5023:Gnb2 UTSW 5 137529940 splice site probably null
R5465:Gnb2 UTSW 5 137528513 missense probably damaging 1.00
R5633:Gnb2 UTSW 5 137529192 missense probably benign 0.12
R5794:Gnb2 UTSW 5 137528699 missense probably benign 0.03
R7107:Gnb2 UTSW 5 137530182 critical splice donor site probably null
R8406:Gnb2 UTSW 5 137528603 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGACTTTTATCTCCACAGTGGG -3'
(R):5'- ACATCTGGGATGCCATGAAG -3'

Sequencing Primer
(F):5'- CCCCTAGAGGAACCAAACCTGG -3'
(R):5'- TGGGATGCCATGAAGGGTGAC -3'
Posted On2016-08-04