Incidental Mutation 'R5395:Mcm5'
ID426122
Institutional Source Beutler Lab
Gene Symbol Mcm5
Ensembl Gene ENSMUSG00000005410
Gene Nameminichromosome maintenance complex component 5
SynonymsCdc46, mCD46, Mcmd5
MMRRC Submission 042967-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5395 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location75109569-75128439 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75123026 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 542 (S542N)
Ref Sequence ENSEMBL: ENSMUSP00000148525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164309] [ENSMUST00000212426] [ENSMUST00000212811]
Predicted Effect probably benign
Transcript: ENSMUST00000164309
AA Change: S542N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126135
Gene: ENSMUSG00000005410
AA Change: S542N

DomainStartEndE-ValueType
MCM 133 649 N/A SMART
Blast:MCM 693 734 2e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211912
Predicted Effect probably benign
Transcript: ENSMUST00000212426
AA Change: S542N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212648
Predicted Effect probably benign
Transcript: ENSMUST00000212811
AA Change: S542N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the oligameric minichromosome maintenance protein complex. During DNA replication, the complex loads onto chromatin in early G1 and is converted into an active replicative helicase during S phase. It functions to limit DNA synthesis to once per cell cycle. During embryogenesis, the encoded protein is negatively regulated through expression of paired box protein Pax 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,080,941 I268V probably benign Het
Actn1 T A 12: 80,170,703 I782F probably benign Het
Adamdec1 A C 14: 68,570,903 S333A probably benign Het
Agbl5 C A 5: 30,890,338 T58N probably damaging Het
Apoo-ps T A 13: 107,414,493 noncoding transcript Het
Arhgef10l T C 4: 140,570,290 N277S probably benign Het
Ascc2 A G 11: 4,659,273 E241G possibly damaging Het
Atp13a4 A T 16: 29,420,888 Y835* probably null Het
Atp13a4 A G 16: 29,456,604 V354A possibly damaging Het
Bcas3 T C 11: 85,825,249 S426P probably damaging Het
Birc3 T C 9: 7,861,174 R48G probably damaging Het
Cacna2d4 T C 6: 119,271,418 S397P possibly damaging Het
Ccng2 T C 5: 93,269,398 M91T possibly damaging Het
Clk3 G A 9: 57,753,339 T473M probably damaging Het
Cog2 T A 8: 124,545,221 H491Q probably benign Het
Cyp4f40 C T 17: 32,669,853 T202I probably benign Het
Dennd1a A T 2: 37,802,128 F181I probably damaging Het
Fcrl6 G T 1: 172,598,720 A170D possibly damaging Het
Fev T C 1: 74,882,664 probably null Het
Flnb A G 14: 7,883,881 N369S probably benign Het
Flt3 A G 5: 147,354,823 F606L probably damaging Het
Gdf9 T C 11: 53,433,797 V131A probably benign Het
Gdnf T A 15: 7,834,684 L192Q probably damaging Het
Gjc2 A T 11: 59,177,489 C56S possibly damaging Het
Gli3 T C 13: 15,714,950 F550L probably damaging Het
Gm1110 T C 9: 26,889,632 E422G probably benign Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gnb2 A G 5: 137,528,526 S334P probably damaging Het
Icam2 A T 11: 106,382,473 probably null Het
Inca1 C T 11: 70,690,438 probably null Het
Itgb8 A C 12: 119,170,741 C530W probably damaging Het
Lrp1 T C 10: 127,595,297 D332G probably damaging Het
Ly75 A T 2: 60,365,111 N234K probably benign Het
Mcm9 A T 10: 53,538,692 N97K possibly damaging Het
Morc2a G A 11: 3,688,232 R986H possibly damaging Het
Neu2 T A 1: 87,596,675 probably null Het
Nfatc1 G A 18: 80,636,020 P718S possibly damaging Het
Nol6 G A 4: 41,118,392 probably benign Het
Olfr1406 A T 1: 173,183,680 Y251* probably null Het
Otogl T C 10: 107,817,138 N1118D probably benign Het
Pcdh15 T A 10: 74,185,287 I111K probably damaging Het
Phkb A G 8: 86,017,468 D582G probably damaging Het
Piwil2 G T 14: 70,395,397 N575K probably benign Het
Pou4f2 T A 8: 78,435,072 I301F probably damaging Het
Prkd1 T C 12: 50,391,432 N409S probably damaging Het
Ptpn21 T G 12: 98,715,117 K86T probably damaging Het
Raly T A 2: 154,864,007 probably null Het
Rangap1 A G 15: 81,706,446 F482L probably benign Het
Rapgef1 T A 2: 29,737,965 N1052K probably damaging Het
Rnf169 A T 7: 99,935,160 probably null Het
Sdr16c5 T C 4: 4,016,277 S50G probably benign Het
Sin3a G A 9: 57,105,673 R612H probably damaging Het
Six6 T A 12: 72,941,701 L216* probably null Het
Slc20a1 A T 2: 129,208,337 N472Y probably damaging Het
Slc35d1 C T 4: 103,211,375 probably null Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slc7a8 C A 14: 54,733,277 G306* probably null Het
Slc9a8 T A 2: 167,467,722 F335L probably damaging Het
Smyd1 T G 6: 71,219,390 K338T possibly damaging Het
Snd1 T A 6: 28,526,184 V187E probably damaging Het
Spag9 T G 11: 94,091,751 probably null Het
Tnfsf9 C A 17: 57,105,592 T54K probably benign Het
Trim24 T G 6: 37,957,744 V798G probably damaging Het
Tyr C A 7: 87,472,490 A365S probably damaging Het
Usp43 T A 11: 67,897,358 probably null Het
Vmn2r55 T C 7: 12,651,947 D702G probably damaging Het
Vmn2r72 A G 7: 85,750,897 S315P possibly damaging Het
Wdr64 T A 1: 175,755,598 F367I probably damaging Het
Zc3h7b G A 15: 81,772,501 R173K possibly damaging Het
Zfp493 T A 13: 67,783,846 C21* probably null Het
Zfp825 T C 13: 74,480,546 T284A possibly damaging Het
Zpbp2 T A 11: 98,558,213 V275D probably damaging Het
Other mutations in Mcm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Mcm5 APN 8 75124945 critical splice donor site probably null
IGL00954:Mcm5 APN 8 75110112 missense possibly damaging 0.78
IGL02534:Mcm5 APN 8 75114233 missense probably damaging 1.00
IGL03074:Mcm5 APN 8 75119301 missense possibly damaging 0.94
IGL03176:Mcm5 APN 8 75109853 missense possibly damaging 0.95
IGL03240:Mcm5 APN 8 75115902 missense probably damaging 1.00
PIT4142001:Mcm5 UTSW 8 75127236 missense probably benign
R0133:Mcm5 UTSW 8 75120911 missense probably damaging 1.00
R0138:Mcm5 UTSW 8 75120880 missense probably damaging 1.00
R0226:Mcm5 UTSW 8 75126252 missense possibly damaging 0.90
R0733:Mcm5 UTSW 8 75127248 missense probably benign 0.08
R1217:Mcm5 UTSW 8 75126291 missense probably benign 0.01
R1601:Mcm5 UTSW 8 75119354 missense possibly damaging 0.87
R1834:Mcm5 UTSW 8 75119273 missense possibly damaging 0.64
R1958:Mcm5 UTSW 8 75121629 missense probably benign 0.34
R3410:Mcm5 UTSW 8 75121644 missense possibly damaging 0.88
R4133:Mcm5 UTSW 8 75115854 missense probably damaging 1.00
R4441:Mcm5 UTSW 8 75112544 missense probably benign 0.39
R5710:Mcm5 UTSW 8 75120910 missense probably damaging 1.00
R5714:Mcm5 UTSW 8 75120910 missense probably damaging 1.00
R6075:Mcm5 UTSW 8 75114197 missense probably damaging 1.00
R6093:Mcm5 UTSW 8 75109746 missense probably benign 0.06
R6477:Mcm5 UTSW 8 75112602 missense probably benign 0.36
R6848:Mcm5 UTSW 8 75127290 missense possibly damaging 0.88
R7098:Mcm5 UTSW 8 75120901 missense probably damaging 1.00
R7208:Mcm5 UTSW 8 75121716 critical splice donor site probably null
R7278:Mcm5 UTSW 8 75124859 missense probably benign 0.40
R7552:Mcm5 UTSW 8 75121592 missense probably damaging 0.99
R7701:Mcm5 UTSW 8 75123923 missense probably benign 0.00
Z1177:Mcm5 UTSW 8 75121672 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- TACTGGAACACAAGCATTTGCC -3'
(R):5'- TTCAGAACAGGGTTACCAGGAAATC -3'

Sequencing Primer
(F):5'- TCACCTCATTGGCTTGGATATG -3'
(R):5'- CAGGGTTACCAGGAAATCCTAGG -3'
Posted On2016-08-04