Incidental Mutation 'R5395:Birc3'
ID426126
Institutional Source Beutler Lab
Gene Symbol Birc3
Ensembl Gene ENSMUSG00000032000
Gene Namebaculoviral IAP repeat-containing 3
SynonymsApi2, cIAP2, cIAP-2, HIAP2, IAP2, MIAP2, MIHC, RNF49
MMRRC Submission 042967-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.565) question?
Stock #R5395 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location7848699-7873186 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7861174 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 48 (R48G)
Ref Sequence ENSEMBL: ENSMUSP00000125652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013949] [ENSMUST00000115672] [ENSMUST00000115673] [ENSMUST00000159323]
Predicted Effect probably damaging
Transcript: ENSMUST00000013949
AA Change: R48G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000013949
Gene: ENSMUSG00000032000
AA Change: R48G

DomainStartEndE-ValueType
BIR 27 98 1.92e-34 SMART
low complexity region 132 145 N/A INTRINSIC
BIR 167 237 2.12e-36 SMART
BIR 253 324 1.5e-36 SMART
CARD 438 525 7.29e-4 SMART
RING 555 589 1.43e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115672
AA Change: R48G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111336
Gene: ENSMUSG00000032000
AA Change: R48G

DomainStartEndE-ValueType
BIR 27 98 1.92e-34 SMART
low complexity region 132 145 N/A INTRINSIC
BIR 167 237 2.12e-36 SMART
BIR 253 324 1.5e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115673
AA Change: R48G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111337
Gene: ENSMUSG00000032000
AA Change: R48G

DomainStartEndE-ValueType
BIR 27 98 1.92e-34 SMART
low complexity region 132 145 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159323
AA Change: R48G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125652
Gene: ENSMUSG00000032000
AA Change: R48G

DomainStartEndE-ValueType
BIR 27 98 1.92e-34 SMART
low complexity region 132 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161642
SMART Domains Protein: ENSMUSP00000125512
Gene: ENSMUSG00000032000

DomainStartEndE-ValueType
SCOP:d1g73d_ 4 35 1e-6 SMART
PDB:3T6P|A 4 106 2e-39 PDB
low complexity region 107 125 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IAP family of proteins that inhibit apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. The encoded protein inhibits apoptosis induced by serum deprivation but does not affect apoptosis resulting from exposure to menadione, a potent inducer of free radicals. It contains 3 baculovirus IAP repeats and a ring finger domain. Transcript variants encoding the same isoform have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a reduced susceptibility to endotoxic shock. Mice homozygous for a knock-in allele exhibit increased B cell survival and proliferation, lymph node hyperplasia, lymphocytic infiltrates in the lungs, and enlarged gut-associated lympoid tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,080,941 I268V probably benign Het
Actn1 T A 12: 80,170,703 I782F probably benign Het
Adamdec1 A C 14: 68,570,903 S333A probably benign Het
Agbl5 C A 5: 30,890,338 T58N probably damaging Het
Apoo-ps T A 13: 107,414,493 noncoding transcript Het
Arhgef10l T C 4: 140,570,290 N277S probably benign Het
Ascc2 A G 11: 4,659,273 E241G possibly damaging Het
Atp13a4 A T 16: 29,420,888 Y835* probably null Het
Atp13a4 A G 16: 29,456,604 V354A possibly damaging Het
Bcas3 T C 11: 85,825,249 S426P probably damaging Het
Cacna2d4 T C 6: 119,271,418 S397P possibly damaging Het
Ccng2 T C 5: 93,269,398 M91T possibly damaging Het
Clk3 G A 9: 57,753,339 T473M probably damaging Het
Cog2 T A 8: 124,545,221 H491Q probably benign Het
Cyp4f40 C T 17: 32,669,853 T202I probably benign Het
Dennd1a A T 2: 37,802,128 F181I probably damaging Het
Fcrl6 G T 1: 172,598,720 A170D possibly damaging Het
Fev T C 1: 74,882,664 probably null Het
Flnb A G 14: 7,883,881 N369S probably benign Het
Flt3 A G 5: 147,354,823 F606L probably damaging Het
Gdf9 T C 11: 53,433,797 V131A probably benign Het
Gdnf T A 15: 7,834,684 L192Q probably damaging Het
Gjc2 A T 11: 59,177,489 C56S possibly damaging Het
Gli3 T C 13: 15,714,950 F550L probably damaging Het
Gm1110 T C 9: 26,889,632 E422G probably benign Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gnb2 A G 5: 137,528,526 S334P probably damaging Het
Icam2 A T 11: 106,382,473 probably null Het
Inca1 C T 11: 70,690,438 probably null Het
Itgb8 A C 12: 119,170,741 C530W probably damaging Het
Lrp1 T C 10: 127,595,297 D332G probably damaging Het
Ly75 A T 2: 60,365,111 N234K probably benign Het
Mcm5 G A 8: 75,123,026 S542N probably benign Het
Mcm9 A T 10: 53,538,692 N97K possibly damaging Het
Morc2a G A 11: 3,688,232 R986H possibly damaging Het
Neu2 T A 1: 87,596,675 probably null Het
Nfatc1 G A 18: 80,636,020 P718S possibly damaging Het
Nol6 G A 4: 41,118,392 probably benign Het
Olfr1406 A T 1: 173,183,680 Y251* probably null Het
Otogl T C 10: 107,817,138 N1118D probably benign Het
Pcdh15 T A 10: 74,185,287 I111K probably damaging Het
Phkb A G 8: 86,017,468 D582G probably damaging Het
Piwil2 G T 14: 70,395,397 N575K probably benign Het
Pou4f2 T A 8: 78,435,072 I301F probably damaging Het
Prkd1 T C 12: 50,391,432 N409S probably damaging Het
Ptpn21 T G 12: 98,715,117 K86T probably damaging Het
Raly T A 2: 154,864,007 probably null Het
Rangap1 A G 15: 81,706,446 F482L probably benign Het
Rapgef1 T A 2: 29,737,965 N1052K probably damaging Het
Rnf169 A T 7: 99,935,160 probably null Het
Sdr16c5 T C 4: 4,016,277 S50G probably benign Het
Sin3a G A 9: 57,105,673 R612H probably damaging Het
Six6 T A 12: 72,941,701 L216* probably null Het
Slc20a1 A T 2: 129,208,337 N472Y probably damaging Het
Slc35d1 C T 4: 103,211,375 probably null Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slc7a8 C A 14: 54,733,277 G306* probably null Het
Slc9a8 T A 2: 167,467,722 F335L probably damaging Het
Smyd1 T G 6: 71,219,390 K338T possibly damaging Het
Snd1 T A 6: 28,526,184 V187E probably damaging Het
Spag9 T G 11: 94,091,751 probably null Het
Tnfsf9 C A 17: 57,105,592 T54K probably benign Het
Trim24 T G 6: 37,957,744 V798G probably damaging Het
Tyr C A 7: 87,472,490 A365S probably damaging Het
Usp43 T A 11: 67,897,358 probably null Het
Vmn2r55 T C 7: 12,651,947 D702G probably damaging Het
Vmn2r72 A G 7: 85,750,897 S315P possibly damaging Het
Wdr64 T A 1: 175,755,598 F367I probably damaging Het
Zc3h7b G A 15: 81,772,501 R173K possibly damaging Het
Zfp493 T A 13: 67,783,846 C21* probably null Het
Zfp825 T C 13: 74,480,546 T284A possibly damaging Het
Zpbp2 T A 11: 98,558,213 V275D probably damaging Het
Other mutations in Birc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Birc3 APN 9 7860732 missense probably damaging 1.00
IGL02852:Birc3 APN 9 7854483 missense probably damaging 0.99
IGL03135:Birc3 APN 9 7849721 splice site probably benign
R0478:Birc3 UTSW 9 7860347 missense probably damaging 1.00
R0905:Birc3 UTSW 9 7851051 makesense probably null
R1934:Birc3 UTSW 9 7854499 missense possibly damaging 0.89
R2005:Birc3 UTSW 9 7860341 missense probably damaging 1.00
R3019:Birc3 UTSW 9 7857389 critical splice donor site probably null
R4169:Birc3 UTSW 9 7849683 missense possibly damaging 0.78
R4964:Birc3 UTSW 9 7860552 missense probably benign 0.01
R5338:Birc3 UTSW 9 7857359 missense probably benign 0.01
R5877:Birc3 UTSW 9 7849346 missense probably damaging 1.00
R5914:Birc3 UTSW 9 7857342 makesense probably null
R6148:Birc3 UTSW 9 7849683 missense possibly damaging 0.78
R6471:Birc3 UTSW 9 7857420 missense probably benign 0.00
R6747:Birc3 UTSW 9 7860261 critical splice donor site probably null
R6752:Birc3 UTSW 9 7857344 missense probably benign 0.10
R6812:Birc3 UTSW 9 7854417 missense probably damaging 0.99
R8078:Birc3 UTSW 9 7858741 missense probably damaging 0.98
R8101:Birc3 UTSW 9 7861004 missense probably benign 0.00
R8314:Birc3 UTSW 9 7872941 intron probably benign
R8371:Birc3 UTSW 9 7849426 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGGCATGGTGCTCATCGC -3'
(R):5'- GAAAGACTTGTCCCTTCCCC -3'

Sequencing Primer
(F):5'- CGAGGACTAGCTTCCAGACTGTTG -3'
(R):5'- CTCCCTGTCATCTCACCATGAAC -3'
Posted On2016-08-04