Incidental Mutation 'R5395:Ptpn21'
ID426147
Institutional Source Beutler Lab
Gene Symbol Ptpn21
Ensembl Gene ENSMUSG00000021009
Gene Nameprotein tyrosine phosphatase, non-receptor type 21
SynonymsPTPD1, PTPRL10
MMRRC Submission 042967-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R5395 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location98676741-98737405 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 98715117 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 86 (K86T)
Ref Sequence ENSEMBL: ENSMUSP00000152639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085116] [ENSMUST00000170188] [ENSMUST00000221148] [ENSMUST00000221535] [ENSMUST00000221932]
Predicted Effect probably damaging
Transcript: ENSMUST00000085116
AA Change: K86T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082197
Gene: ENSMUSG00000021009
AA Change: K86T

DomainStartEndE-ValueType
B41 19 222 5.04e-69 SMART
FERM_C 226 312 4.66e-26 SMART
low complexity region 332 343 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
PTPc 897 1171 7.31e-111 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170188
AA Change: K86T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126975
Gene: ENSMUSG00000021009
AA Change: K86T

DomainStartEndE-ValueType
B41 19 222 5.04e-69 SMART
FERM_C 226 312 4.66e-26 SMART
low complexity region 332 343 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
PTPc 897 1171 7.31e-111 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000221148
AA Change: K86T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000221535
AA Change: K86T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000221932
AA Change: K86T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222071
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal domain, similar to cytoskeletal- associated proteins including band 4.1, ezrin, merlin, and radixin. This PTP was shown to specially interact with BMX/ETK, a member of Tec tyrosine kinase family characterized by a multimodular structures including PH, SH3, and SH2 domains. The interaction of this PTP with BMX kinase was found to increase the activation of STAT3, but not STAT2 kinase. Studies of the similar gene in mice suggested the possible roles of this PTP in liver regeneration and spermatogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,080,941 I268V probably benign Het
Actn1 T A 12: 80,170,703 I782F probably benign Het
Adamdec1 A C 14: 68,570,903 S333A probably benign Het
Agbl5 C A 5: 30,890,338 T58N probably damaging Het
Apoo-ps T A 13: 107,414,493 noncoding transcript Het
Arhgef10l T C 4: 140,570,290 N277S probably benign Het
Ascc2 A G 11: 4,659,273 E241G possibly damaging Het
Atp13a4 A T 16: 29,420,888 Y835* probably null Het
Atp13a4 A G 16: 29,456,604 V354A possibly damaging Het
Bcas3 T C 11: 85,825,249 S426P probably damaging Het
Birc3 T C 9: 7,861,174 R48G probably damaging Het
Cacna2d4 T C 6: 119,271,418 S397P possibly damaging Het
Ccng2 T C 5: 93,269,398 M91T possibly damaging Het
Clk3 G A 9: 57,753,339 T473M probably damaging Het
Cog2 T A 8: 124,545,221 H491Q probably benign Het
Cyp4f40 C T 17: 32,669,853 T202I probably benign Het
Dennd1a A T 2: 37,802,128 F181I probably damaging Het
Fcrl6 G T 1: 172,598,720 A170D possibly damaging Het
Fev T C 1: 74,882,664 probably null Het
Flnb A G 14: 7,883,881 N369S probably benign Het
Flt3 A G 5: 147,354,823 F606L probably damaging Het
Gdf9 T C 11: 53,433,797 V131A probably benign Het
Gdnf T A 15: 7,834,684 L192Q probably damaging Het
Gjc2 A T 11: 59,177,489 C56S possibly damaging Het
Gli3 T C 13: 15,714,950 F550L probably damaging Het
Gm1110 T C 9: 26,889,632 E422G probably benign Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gnb2 A G 5: 137,528,526 S334P probably damaging Het
Icam2 A T 11: 106,382,473 probably null Het
Inca1 C T 11: 70,690,438 probably null Het
Itgb8 A C 12: 119,170,741 C530W probably damaging Het
Lrp1 T C 10: 127,595,297 D332G probably damaging Het
Ly75 A T 2: 60,365,111 N234K probably benign Het
Mcm5 G A 8: 75,123,026 S542N probably benign Het
Mcm9 A T 10: 53,538,692 N97K possibly damaging Het
Morc2a G A 11: 3,688,232 R986H possibly damaging Het
Neu2 T A 1: 87,596,675 probably null Het
Nfatc1 G A 18: 80,636,020 P718S possibly damaging Het
Nol6 G A 4: 41,118,392 probably benign Het
Olfr1406 A T 1: 173,183,680 Y251* probably null Het
Otogl T C 10: 107,817,138 N1118D probably benign Het
Pcdh15 T A 10: 74,185,287 I111K probably damaging Het
Phkb A G 8: 86,017,468 D582G probably damaging Het
Piwil2 G T 14: 70,395,397 N575K probably benign Het
Pou4f2 T A 8: 78,435,072 I301F probably damaging Het
Prkd1 T C 12: 50,391,432 N409S probably damaging Het
Raly T A 2: 154,864,007 probably null Het
Rangap1 A G 15: 81,706,446 F482L probably benign Het
Rapgef1 T A 2: 29,737,965 N1052K probably damaging Het
Rnf169 A T 7: 99,935,160 probably null Het
Sdr16c5 T C 4: 4,016,277 S50G probably benign Het
Sin3a G A 9: 57,105,673 R612H probably damaging Het
Six6 T A 12: 72,941,701 L216* probably null Het
Slc20a1 A T 2: 129,208,337 N472Y probably damaging Het
Slc35d1 C T 4: 103,211,375 probably null Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slc7a8 C A 14: 54,733,277 G306* probably null Het
Slc9a8 T A 2: 167,467,722 F335L probably damaging Het
Smyd1 T G 6: 71,219,390 K338T possibly damaging Het
Snd1 T A 6: 28,526,184 V187E probably damaging Het
Spag9 T G 11: 94,091,751 probably null Het
Tnfsf9 C A 17: 57,105,592 T54K probably benign Het
Trim24 T G 6: 37,957,744 V798G probably damaging Het
Tyr C A 7: 87,472,490 A365S probably damaging Het
Usp43 T A 11: 67,897,358 probably null Het
Vmn2r55 T C 7: 12,651,947 D702G probably damaging Het
Vmn2r72 A G 7: 85,750,897 S315P possibly damaging Het
Wdr64 T A 1: 175,755,598 F367I probably damaging Het
Zc3h7b G A 15: 81,772,501 R173K possibly damaging Het
Zfp493 T A 13: 67,783,846 C21* probably null Het
Zfp825 T C 13: 74,480,546 T284A possibly damaging Het
Zpbp2 T A 11: 98,558,213 V275D probably damaging Het
Other mutations in Ptpn21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Ptpn21 APN 12 98680468 missense probably damaging 1.00
IGL00576:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00577:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00580:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00583:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00773:Ptpn21 APN 12 98688313 missense probably benign 0.00
IGL00780:Ptpn21 APN 12 98680371 missense probably damaging 1.00
IGL01516:Ptpn21 APN 12 98715189 missense probably damaging 1.00
IGL01616:Ptpn21 APN 12 98680013 missense probably damaging 1.00
IGL01939:Ptpn21 APN 12 98689161 missense probably damaging 0.96
IGL02237:Ptpn21 APN 12 98705092 critical splice donor site probably null
IGL02512:Ptpn21 APN 12 98679392 missense probably benign 0.00
IGL02852:Ptpn21 APN 12 98715195 critical splice acceptor site probably null
IGL02894:Ptpn21 APN 12 98689632 splice site probably benign
IGL03024:Ptpn21 APN 12 98680056 missense probably benign
IGL03220:Ptpn21 APN 12 98678623 missense probably damaging 1.00
R0144:Ptpn21 UTSW 12 98688609 missense probably benign 0.01
R0472:Ptpn21 UTSW 12 98704240 splice site probably benign
R0675:Ptpn21 UTSW 12 98688216 missense probably benign 0.16
R0771:Ptpn21 UTSW 12 98689080 missense probably damaging 1.00
R1434:Ptpn21 UTSW 12 98688590 missense probably damaging 1.00
R1470:Ptpn21 UTSW 12 98688476 missense probably benign
R1470:Ptpn21 UTSW 12 98688476 missense probably benign
R1837:Ptpn21 UTSW 12 98733626 missense probably damaging 0.99
R1897:Ptpn21 UTSW 12 98680405 unclassified probably null
R2048:Ptpn21 UTSW 12 98689526 missense possibly damaging 0.94
R2376:Ptpn21 UTSW 12 98688314 missense possibly damaging 0.62
R3709:Ptpn21 UTSW 12 98688541 missense probably benign
R4197:Ptpn21 UTSW 12 98680138 missense probably damaging 1.00
R4283:Ptpn21 UTSW 12 98733475 missense probably damaging 0.99
R4368:Ptpn21 UTSW 12 98678593 missense probably damaging 1.00
R4397:Ptpn21 UTSW 12 98688248 missense probably damaging 1.00
R4397:Ptpn21 UTSW 12 98715060 missense probably damaging 0.98
R4703:Ptpn21 UTSW 12 98679392 missense probably benign 0.00
R4737:Ptpn21 UTSW 12 98708844 missense probably benign 0.03
R4829:Ptpn21 UTSW 12 98689296 missense probably damaging 1.00
R4926:Ptpn21 UTSW 12 98715195 critical splice acceptor site probably null
R4974:Ptpn21 UTSW 12 98680103 missense probably damaging 1.00
R5022:Ptpn21 UTSW 12 98679407 missense probably damaging 1.00
R5057:Ptpn21 UTSW 12 98679407 missense probably damaging 1.00
R5608:Ptpn21 UTSW 12 98688777 missense probably benign 0.00
R5741:Ptpn21 UTSW 12 98679289 missense probably damaging 1.00
R5785:Ptpn21 UTSW 12 98682550 missense probably damaging 0.99
R5959:Ptpn21 UTSW 12 98708889 splice site probably null
R5968:Ptpn21 UTSW 12 98710890 missense probably damaging 1.00
R5984:Ptpn21 UTSW 12 98689076 missense probably damaging 1.00
R6005:Ptpn21 UTSW 12 98678552 makesense probably null
R6181:Ptpn21 UTSW 12 98699999 missense probably damaging 0.99
R6226:Ptpn21 UTSW 12 98680116 missense probably benign 0.24
R6226:Ptpn21 UTSW 12 98715172 missense probably damaging 1.00
R6317:Ptpn21 UTSW 12 98689262 missense probably damaging 1.00
R6370:Ptpn21 UTSW 12 98689034 missense possibly damaging 0.86
R6485:Ptpn21 UTSW 12 98698872 nonsense probably null
R6894:Ptpn21 UTSW 12 98715181 missense probably damaging 1.00
R7122:Ptpn21 UTSW 12 98688912 missense probably damaging 0.99
R7232:Ptpn21 UTSW 12 98688737 missense probably benign 0.17
R7289:Ptpn21 UTSW 12 98704191 missense probably benign 0.35
R7327:Ptpn21 UTSW 12 98680101 missense probably damaging 1.00
R7474:Ptpn21 UTSW 12 98737363 critical splice donor site probably null
R7748:Ptpn21 UTSW 12 98688772 missense probably benign 0.01
R7816:Ptpn21 UTSW 12 98682532 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCTTTATCTCAAGGACCTTTG -3'
(R):5'- CTCGTAAGCCTTGCCTGTTG -3'

Sequencing Primer
(F):5'- TATCTCAAGGACCTTTGACCCCAG -3'
(R):5'- CCTTCTGAAAGGCACAGGAG -3'
Posted On2016-08-04