Mutagenetix > Incidental Mutations

Incidental Mutation 'R5395:Ptpn21'

426147

Institutional Source

Beutler Lab

Gene Symbol

Ptpn21

Ensembl Gene

ENSMUSG00000021009

Gene Name

protein tyrosine phosphatase, non-receptor type 21

Synonyms

PTPD1, PTPRL10

MMRRC Submission

042967-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.139) question?

Stock #

R5395 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

98676741-98737405 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 98715117 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Threonine at position 86 (K86T)

Ref Sequence

ENSEMBL: ENSMUSP00000152639 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085116] [ENSMUST00000170188] [ENSMUST00000221148] [ENSMUST00000221535] [ENSMUST00000221932]

Predicted Effect

probably damaging
Transcript: ENSMUST00000085116
AA Change: K86T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000082197
Gene: ENSMUSG00000021009
AA Change: K86T

Domain	Start	End	E-Value	Type
B41	19	222	5.04e-69	SMART
FERM_C	226	312	4.66e-26	SMART
low complexity region	332	343	N/A	INTRINSIC
low complexity region	563	574	N/A	INTRINSIC
low complexity region	710	724	N/A	INTRINSIC
PTPc	897	1171	7.31e-111	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000170188
AA Change: K86T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126975
Gene: ENSMUSG00000021009
AA Change: K86T

Domain	Start	End	E-Value	Type
B41	19	222	5.04e-69	SMART
FERM_C	226	312	4.66e-26	SMART
low complexity region	332	343	N/A	INTRINSIC
low complexity region	563	574	N/A	INTRINSIC
low complexity region	710	724	N/A	INTRINSIC
PTPc	897	1171	7.31e-111	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000221148
AA Change: K86T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000221535
AA Change: K86T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000221932
AA Change: K86T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222071

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal domain, similar to cytoskeletal- associated proteins including band 4.1, ezrin, merlin, and radixin. This PTP was shown to specially interact with BMX/ETK, a member of Tec tyrosine kinase family characterized by a multimodular structures including PH, SH3, and SH2 domains. The interaction of this PTP with BMX kinase was found to increase the activation of STAT3, but not STAT2 kinase. Studies of the similar gene in mice suggested the possible roles of this PTP in liver regeneration and spermatogenesis. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	A	G	3: 122,080,941	I268V	probably benign	Het
Actn1	T	A	12: 80,170,703	I782F	probably benign	Het
Adamdec1	A	C	14: 68,570,903	S333A	probably benign	Het
Agbl5	C	A	5: 30,890,338	T58N	probably damaging	Het
Apoo-ps	T	A	13: 107,414,493		noncoding transcript	Het
Arhgef10l	T	C	4: 140,570,290	N277S	probably benign	Het
Ascc2	A	G	11: 4,659,273	E241G	possibly damaging	Het
Atp13a4	A	T	16: 29,420,888	Y835*	probably null	Het
Atp13a4	A	G	16: 29,456,604	V354A	possibly damaging	Het
Bcas3	T	C	11: 85,825,249	S426P	probably damaging	Het
Birc3	T	C	9: 7,861,174	R48G	probably damaging	Het
Cacna2d4	T	C	6: 119,271,418	S397P	possibly damaging	Het
Ccng2	T	C	5: 93,269,398	M91T	possibly damaging	Het
Clk3	G	A	9: 57,753,339	T473M	probably damaging	Het
Cog2	T	A	8: 124,545,221	H491Q	probably benign	Het
Cyp4f40	C	T	17: 32,669,853	T202I	probably benign	Het
Dennd1a	A	T	2: 37,802,128	F181I	probably damaging	Het
Fcrl6	G	T	1: 172,598,720	A170D	possibly damaging	Het
Fev	T	C	1: 74,882,664		probably null	Het
Flnb	A	G	14: 7,883,881	N369S	probably benign	Het
Flt3	A	G	5: 147,354,823	F606L	probably damaging	Het
Gdf9	T	C	11: 53,433,797	V131A	probably benign	Het
Gdnf	T	A	15: 7,834,684	L192Q	probably damaging	Het
Gjc2	A	T	11: 59,177,489	C56S	possibly damaging	Het
Gli3	T	C	13: 15,714,950	F550L	probably damaging	Het
Gm1110	T	C	9: 26,889,632	E422G	probably benign	Het
Gm14325	G	A	2: 177,832,984	H102Y	possibly damaging	Het
Gnb2	A	G	5: 137,528,526	S334P	probably damaging	Het
Icam2	A	T	11: 106,382,473		probably null	Het
Inca1	C	T	11: 70,690,438		probably null	Het
Itgb8	A	C	12: 119,170,741	C530W	probably damaging	Het
Lrp1	T	C	10: 127,595,297	D332G	probably damaging	Het
Ly75	A	T	2: 60,365,111	N234K	probably benign	Het
Mcm5	G	A	8: 75,123,026	S542N	probably benign	Het
Mcm9	A	T	10: 53,538,692	N97K	possibly damaging	Het
Morc2a	G	A	11: 3,688,232	R986H	possibly damaging	Het
Neu2	T	A	1: 87,596,675		probably null	Het
Nfatc1	G	A	18: 80,636,020	P718S	possibly damaging	Het
Nol6	G	A	4: 41,118,392		probably benign	Het
Olfr1406	A	T	1: 173,183,680	Y251*	probably null	Het
Otogl	T	C	10: 107,817,138	N1118D	probably benign	Het
Pcdh15	T	A	10: 74,185,287	I111K	probably damaging	Het
Phkb	A	G	8: 86,017,468	D582G	probably damaging	Het
Piwil2	G	T	14: 70,395,397	N575K	probably benign	Het
Pou4f2	T	A	8: 78,435,072	I301F	probably damaging	Het
Prkd1	T	C	12: 50,391,432	N409S	probably damaging	Het
Raly	T	A	2: 154,864,007		probably null	Het
Rangap1	A	G	15: 81,706,446	F482L	probably benign	Het
Rapgef1	T	A	2: 29,737,965	N1052K	probably damaging	Het
Rnf169	A	T	7: 99,935,160		probably null	Het
Sdr16c5	T	C	4: 4,016,277	S50G	probably benign	Het
Sin3a	G	A	9: 57,105,673	R612H	probably damaging	Het
Six6	T	A	12: 72,941,701	L216*	probably null	Het
Slc20a1	A	T	2: 129,208,337	N472Y	probably damaging	Het
Slc35d1	C	T	4: 103,211,375		probably null	Het
Slc45a2	C	T	15: 11,027,785	T480I	probably damaging	Het
Slc7a8	C	A	14: 54,733,277	G306*	probably null	Het
Slc9a8	T	A	2: 167,467,722	F335L	probably damaging	Het
Smyd1	T	G	6: 71,219,390	K338T	possibly damaging	Het
Snd1	T	A	6: 28,526,184	V187E	probably damaging	Het
Spag9	T	G	11: 94,091,751		probably null	Het
Tnfsf9	C	A	17: 57,105,592	T54K	probably benign	Het
Trim24	T	G	6: 37,957,744	V798G	probably damaging	Het
Tyr	C	A	7: 87,472,490	A365S	probably damaging	Het
Usp43	T	A	11: 67,897,358		probably null	Het
Vmn2r55	T	C	7: 12,651,947	D702G	probably damaging	Het
Vmn2r72	A	G	7: 85,750,897	S315P	possibly damaging	Het
Wdr64	T	A	1: 175,755,598	F367I	probably damaging	Het
Zc3h7b	G	A	15: 81,772,501	R173K	possibly damaging	Het
Zfp493	T	A	13: 67,783,846	C21*	probably null	Het
Zfp825	T	C	13: 74,480,546	T284A	possibly damaging	Het
Zpbp2	T	A	11: 98,558,213	V275D	probably damaging	Het

Other mutations in Ptpn21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Ptpn21	APN	12	98680468	missense	probably damaging	1.00
IGL00576:Ptpn21	APN	12	98733601	missense	probably damaging	1.00
IGL00577:Ptpn21	APN	12	98733601	missense	probably damaging	1.00
IGL00580:Ptpn21	APN	12	98733601	missense	probably damaging	1.00
IGL00583:Ptpn21	APN	12	98733601	missense	probably damaging	1.00
IGL00773:Ptpn21	APN	12	98688313	missense	probably benign	0.00
IGL00780:Ptpn21	APN	12	98680371	missense	probably damaging	1.00
IGL01516:Ptpn21	APN	12	98715189	missense	probably damaging	1.00
IGL01616:Ptpn21	APN	12	98680013	missense	probably damaging	1.00
IGL01939:Ptpn21	APN	12	98689161	missense	probably damaging	0.96
IGL02237:Ptpn21	APN	12	98705092	critical splice donor site	probably null
IGL02512:Ptpn21	APN	12	98679392	missense	probably benign	0.00
IGL02852:Ptpn21	APN	12	98715195	critical splice acceptor site	probably null
IGL02894:Ptpn21	APN	12	98689632	splice site	probably benign
IGL03024:Ptpn21	APN	12	98680056	missense	probably benign
IGL03220:Ptpn21	APN	12	98678623	missense	probably damaging	1.00
R0144:Ptpn21	UTSW	12	98688609	missense	probably benign	0.01
R0472:Ptpn21	UTSW	12	98704240	splice site	probably benign
R0675:Ptpn21	UTSW	12	98688216	missense	probably benign	0.16
R0771:Ptpn21	UTSW	12	98689080	missense	probably damaging	1.00
R1434:Ptpn21	UTSW	12	98688590	missense	probably damaging	1.00
R1470:Ptpn21	UTSW	12	98688476	missense	probably benign
R1470:Ptpn21	UTSW	12	98688476	missense	probably benign
R1837:Ptpn21	UTSW	12	98733626	missense	probably damaging	0.99
R1897:Ptpn21	UTSW	12	98680405	unclassified	probably null
R2048:Ptpn21	UTSW	12	98689526	missense	possibly damaging	0.94
R2376:Ptpn21	UTSW	12	98688314	missense	possibly damaging	0.62
R3709:Ptpn21	UTSW	12	98688541	missense	probably benign
R4197:Ptpn21	UTSW	12	98680138	missense	probably damaging	1.00
R4283:Ptpn21	UTSW	12	98733475	missense	probably damaging	0.99
R4368:Ptpn21	UTSW	12	98678593	missense	probably damaging	1.00
R4397:Ptpn21	UTSW	12	98688248	missense	probably damaging	1.00
R4397:Ptpn21	UTSW	12	98715060	missense	probably damaging	0.98
R4703:Ptpn21	UTSW	12	98679392	missense	probably benign	0.00
R4737:Ptpn21	UTSW	12	98708844	missense	probably benign	0.03
R4829:Ptpn21	UTSW	12	98689296	missense	probably damaging	1.00
R4926:Ptpn21	UTSW	12	98715195	critical splice acceptor site	probably null
R4974:Ptpn21	UTSW	12	98680103	missense	probably damaging	1.00
R5022:Ptpn21	UTSW	12	98679407	missense	probably damaging	1.00
R5057:Ptpn21	UTSW	12	98679407	missense	probably damaging	1.00
R5608:Ptpn21	UTSW	12	98688777	missense	probably benign	0.00
R5741:Ptpn21	UTSW	12	98679289	missense	probably damaging	1.00
R5785:Ptpn21	UTSW	12	98682550	missense	probably damaging	0.99
R5959:Ptpn21	UTSW	12	98708889	splice site	probably null
R5968:Ptpn21	UTSW	12	98710890	missense	probably damaging	1.00
R5984:Ptpn21	UTSW	12	98689076	missense	probably damaging	1.00
R6005:Ptpn21	UTSW	12	98678552	makesense	probably null
R6181:Ptpn21	UTSW	12	98699999	missense	probably damaging	0.99
R6226:Ptpn21	UTSW	12	98680116	missense	probably benign	0.24
R6226:Ptpn21	UTSW	12	98715172	missense	probably damaging	1.00
R6317:Ptpn21	UTSW	12	98689262	missense	probably damaging	1.00
R6370:Ptpn21	UTSW	12	98689034	missense	possibly damaging	0.86
R6485:Ptpn21	UTSW	12	98698872	nonsense	probably null
R6894:Ptpn21	UTSW	12	98715181	missense	probably damaging	1.00
R7122:Ptpn21	UTSW	12	98688912	missense	probably damaging	0.99
R7232:Ptpn21	UTSW	12	98688737	missense	probably benign	0.17
R7289:Ptpn21	UTSW	12	98704191	missense	probably benign	0.35
R7327:Ptpn21	UTSW	12	98680101	missense	probably damaging	1.00
R7474:Ptpn21	UTSW	12	98737363	critical splice donor site	probably null
R7748:Ptpn21	UTSW	12	98688772	missense	probably benign	0.01
R7816:Ptpn21	UTSW	12	98682532	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCCTTTATCTCAAGGACCTTTG -3'
(R):5'- CTCGTAAGCCTTGCCTGTTG -3'

Sequencing Primer
(F):5'- TATCTCAAGGACCTTTGACCCCAG -3'
(R):5'- CCTTCTGAAAGGCACAGGAG -3'

Posted On

2016-08-04