Incidental Mutation 'R5395:Flnb'
ID426152
Institutional Source Beutler Lab
Gene Symbol Flnb
Ensembl Gene ENSMUSG00000025278
Gene Namefilamin, beta
Synonyms
MMRRC Submission 042967-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5395 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location7817957-7951588 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7883881 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 369 (N369S)
Ref Sequence ENSEMBL: ENSMUSP00000052020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052678]
Predicted Effect probably benign
Transcript: ENSMUST00000052678
AA Change: N369S

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000052020
Gene: ENSMUSG00000025278
AA Change: N369S

DomainStartEndE-ValueType
CH 18 120 2.38e-26 SMART
CH 141 237 1.83e-18 SMART
IG_FLMN 253 350 1.17e-33 SMART
IG_FLMN 353 449 2.08e-34 SMART
IG_FLMN 451 546 3.42e-35 SMART
IG_FLMN 548 639 6.06e-27 SMART
IG_FLMN 644 739 1.94e-34 SMART
IG_FLMN 741 842 4.25e-31 SMART
IG_FLMN 844 941 5.16e-30 SMART
IG_FLMN 943 1037 5.12e-25 SMART
IG_FLMN 1039 1130 5.31e-41 SMART
IG_FLMN 1132 1225 1.4e-31 SMART
IG_FLMN 1227 1325 1.42e-32 SMART
IG_FLMN 1327 1418 5.19e-35 SMART
IG_FLMN 1420 1514 2.48e-41 SMART
IG_FLMN 1516 1611 3.15e-34 SMART
IG_FLMN 1613 1707 4.99e-37 SMART
IG_FLMN 1730 1819 4.44e-11 SMART
IG_FLMN 1820 1911 5.82e-38 SMART
IG_FLMN 1914 1997 5.68e-9 SMART
IG_FLMN 2001 2092 4.45e-34 SMART
IG_FLMN 2101 2188 1.24e-9 SMART
IG_FLMN 2192 2283 4.48e-39 SMART
IG_FLMN 2286 2378 2.94e-25 SMART
IG_FLMN 2383 2474 5.66e-27 SMART
IG_FLMN 2511 2602 1.63e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228206
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the filamin family. The encoded protein interacts with glycoprotein Ib alpha as part of the process to repair vascular injuries. The platelet glycoprotein Ib complex includes glycoprotein Ib alpha, and it binds the actin cytoskeleton. Mutations in this gene have been found in several conditions: atelosteogenesis type 1 and type 3; boomerang dysplasia; autosomal dominant Larsen syndrome; and spondylocarpotarsal synostosis syndrome. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mutations in this gene cause skeletal defects including runting, premature mineralization, and bone fusion. Nullizygous mice show a delay and reduction in long bone growth. Truncation mutations cause early fusion of spinal vertebrae due to enhanced chondrocyte hypertrophy and early differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,080,941 I268V probably benign Het
Actn1 T A 12: 80,170,703 I782F probably benign Het
Adamdec1 A C 14: 68,570,903 S333A probably benign Het
Agbl5 C A 5: 30,890,338 T58N probably damaging Het
Apoo-ps T A 13: 107,414,493 noncoding transcript Het
Arhgef10l T C 4: 140,570,290 N277S probably benign Het
Ascc2 A G 11: 4,659,273 E241G possibly damaging Het
Atp13a4 A T 16: 29,420,888 Y835* probably null Het
Atp13a4 A G 16: 29,456,604 V354A possibly damaging Het
Bcas3 T C 11: 85,825,249 S426P probably damaging Het
Birc3 T C 9: 7,861,174 R48G probably damaging Het
Cacna2d4 T C 6: 119,271,418 S397P possibly damaging Het
Ccng2 T C 5: 93,269,398 M91T possibly damaging Het
Clk3 G A 9: 57,753,339 T473M probably damaging Het
Cog2 T A 8: 124,545,221 H491Q probably benign Het
Cyp4f40 C T 17: 32,669,853 T202I probably benign Het
Dennd1a A T 2: 37,802,128 F181I probably damaging Het
Fcrl6 G T 1: 172,598,720 A170D possibly damaging Het
Fev T C 1: 74,882,664 probably null Het
Flt3 A G 5: 147,354,823 F606L probably damaging Het
Gdf9 T C 11: 53,433,797 V131A probably benign Het
Gdnf T A 15: 7,834,684 L192Q probably damaging Het
Gjc2 A T 11: 59,177,489 C56S possibly damaging Het
Gli3 T C 13: 15,714,950 F550L probably damaging Het
Gm1110 T C 9: 26,889,632 E422G probably benign Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gnb2 A G 5: 137,528,526 S334P probably damaging Het
Icam2 A T 11: 106,382,473 probably null Het
Inca1 C T 11: 70,690,438 probably null Het
Itgb8 A C 12: 119,170,741 C530W probably damaging Het
Lrp1 T C 10: 127,595,297 D332G probably damaging Het
Ly75 A T 2: 60,365,111 N234K probably benign Het
Mcm5 G A 8: 75,123,026 S542N probably benign Het
Mcm9 A T 10: 53,538,692 N97K possibly damaging Het
Morc2a G A 11: 3,688,232 R986H possibly damaging Het
Neu2 T A 1: 87,596,675 probably null Het
Nfatc1 G A 18: 80,636,020 P718S possibly damaging Het
Nol6 G A 4: 41,118,392 probably benign Het
Olfr1406 A T 1: 173,183,680 Y251* probably null Het
Otogl T C 10: 107,817,138 N1118D probably benign Het
Pcdh15 T A 10: 74,185,287 I111K probably damaging Het
Phkb A G 8: 86,017,468 D582G probably damaging Het
Piwil2 G T 14: 70,395,397 N575K probably benign Het
Pou4f2 T A 8: 78,435,072 I301F probably damaging Het
Prkd1 T C 12: 50,391,432 N409S probably damaging Het
Ptpn21 T G 12: 98,715,117 K86T probably damaging Het
Raly T A 2: 154,864,007 probably null Het
Rangap1 A G 15: 81,706,446 F482L probably benign Het
Rapgef1 T A 2: 29,737,965 N1052K probably damaging Het
Rnf169 A T 7: 99,935,160 probably null Het
Sdr16c5 T C 4: 4,016,277 S50G probably benign Het
Sin3a G A 9: 57,105,673 R612H probably damaging Het
Six6 T A 12: 72,941,701 L216* probably null Het
Slc20a1 A T 2: 129,208,337 N472Y probably damaging Het
Slc35d1 C T 4: 103,211,375 probably null Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slc7a8 C A 14: 54,733,277 G306* probably null Het
Slc9a8 T A 2: 167,467,722 F335L probably damaging Het
Smyd1 T G 6: 71,219,390 K338T possibly damaging Het
Snd1 T A 6: 28,526,184 V187E probably damaging Het
Spag9 T G 11: 94,091,751 probably null Het
Tnfsf9 C A 17: 57,105,592 T54K probably benign Het
Trim24 T G 6: 37,957,744 V798G probably damaging Het
Tyr C A 7: 87,472,490 A365S probably damaging Het
Usp43 T A 11: 67,897,358 probably null Het
Vmn2r55 T C 7: 12,651,947 D702G probably damaging Het
Vmn2r72 A G 7: 85,750,897 S315P possibly damaging Het
Wdr64 T A 1: 175,755,598 F367I probably damaging Het
Zc3h7b G A 15: 81,772,501 R173K possibly damaging Het
Zfp493 T A 13: 67,783,846 C21* probably null Het
Zfp825 T C 13: 74,480,546 T284A possibly damaging Het
Zpbp2 T A 11: 98,558,213 V275D probably damaging Het
Other mutations in Flnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Flnb APN 14 7917390 splice site probably benign
IGL01063:Flnb APN 14 7926518 splice site probably benign
IGL01135:Flnb APN 14 7909736 missense probably benign
IGL01139:Flnb APN 14 7945989 missense probably damaging 1.00
IGL01364:Flnb APN 14 7934562 critical splice acceptor site probably null
IGL01417:Flnb APN 14 7905513 missense probably damaging 0.99
IGL01505:Flnb APN 14 7902003 critical splice donor site probably null
IGL01560:Flnb APN 14 7893829 missense probably benign 0.07
IGL01621:Flnb APN 14 7950470 missense probably damaging 1.00
IGL01656:Flnb APN 14 7902010 splice site probably benign
IGL01889:Flnb APN 14 7935967 missense possibly damaging 0.85
IGL01987:Flnb APN 14 7922748 critical splice donor site probably null
IGL02322:Flnb APN 14 7894676 missense probably damaging 1.00
IGL02496:Flnb APN 14 7930919 splice site probably benign
IGL02752:Flnb APN 14 7917338 missense probably benign
IGL03001:Flnb APN 14 7934680 missense probably damaging 0.99
IGL03076:Flnb APN 14 7901988 missense probably benign 0.01
IGL03085:Flnb APN 14 7882211 missense probably benign
IGL03170:Flnb APN 14 7818261 missense possibly damaging 0.90
IGL03373:Flnb APN 14 7890867 critical splice donor site probably null
Boomerang UTSW 14 7901945 missense probably damaging 1.00
Queensland UTSW 14 7927352 missense probably damaging 1.00
R3437_Flnb_252 UTSW 14 7942057 missense probably damaging 0.97
R8441_Flnb_221 UTSW 14 7896488 missense probably benign 0.15
Rhodelinda UTSW 14 7887682 splice site probably benign
saul UTSW 14 7889183 missense probably damaging 0.99
Xerxes UTSW 14 7867551 missense probably damaging 1.00
R0068:Flnb UTSW 14 7915290 missense possibly damaging 0.49
R0068:Flnb UTSW 14 7915290 missense possibly damaging 0.49
R0084:Flnb UTSW 14 7935979 missense probably benign
R0128:Flnb UTSW 14 7901951 missense probably damaging 0.99
R0130:Flnb UTSW 14 7901951 missense probably damaging 0.99
R0148:Flnb UTSW 14 7939077 missense probably benign 0.01
R0166:Flnb UTSW 14 7896115 missense probably damaging 1.00
R0376:Flnb UTSW 14 7946014 critical splice donor site probably null
R0547:Flnb UTSW 14 7912943 splice site probably null
R0612:Flnb UTSW 14 7887682 splice site probably benign
R0656:Flnb UTSW 14 7927352 missense probably damaging 1.00
R0691:Flnb UTSW 14 7890810 missense probably benign 0.16
R1241:Flnb UTSW 14 7896503 missense probably benign 0.06
R1572:Flnb UTSW 14 7883908 missense probably damaging 0.97
R1682:Flnb UTSW 14 7913121 missense probably benign 0.04
R1807:Flnb UTSW 14 7934645 missense probably benign 0.26
R1848:Flnb UTSW 14 7892113 missense probably damaging 1.00
R1959:Flnb UTSW 14 7884735 nonsense probably null
R2078:Flnb UTSW 14 7927466 missense probably damaging 1.00
R2132:Flnb UTSW 14 7873376 missense probably benign 0.04
R2209:Flnb UTSW 14 7905507 nonsense probably null
R2212:Flnb UTSW 14 7881652 small deletion probably benign
R2213:Flnb UTSW 14 7881652 small deletion probably benign
R2363:Flnb UTSW 14 7945950 missense possibly damaging 0.95
R2415:Flnb UTSW 14 7929932 missense probably benign 0.07
R2983:Flnb UTSW 14 7882250 missense probably damaging 1.00
R3001:Flnb UTSW 14 7907162 missense probably benign 0.22
R3002:Flnb UTSW 14 7907162 missense probably benign 0.22
R3436:Flnb UTSW 14 7942057 missense probably damaging 0.97
R3437:Flnb UTSW 14 7942057 missense probably damaging 0.97
R3778:Flnb UTSW 14 7915353 missense probably benign 0.06
R3783:Flnb UTSW 14 7889236 missense probably benign 0.04
R4162:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4163:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4164:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4356:Flnb UTSW 14 7922700 missense probably benign
R4369:Flnb UTSW 14 7942216 missense probably benign
R4783:Flnb UTSW 14 7905701 missense probably benign 0.12
R4785:Flnb UTSW 14 7905701 missense probably benign 0.12
R4790:Flnb UTSW 14 7905661 missense probably benign 0.34
R4828:Flnb UTSW 14 7919238 missense probably benign 0.13
R4882:Flnb UTSW 14 7929936 missense possibly damaging 0.56
R5002:Flnb UTSW 14 7945882 missense probably damaging 1.00
R5058:Flnb UTSW 14 7924262 nonsense probably null
R5184:Flnb UTSW 14 7901945 missense probably damaging 1.00
R5186:Flnb UTSW 14 7909748 missense probably damaging 1.00
R5421:Flnb UTSW 14 7926494 missense probably damaging 1.00
R5667:Flnb UTSW 14 7890843 missense probably benign 0.00
R5671:Flnb UTSW 14 7890843 missense probably benign 0.00
R5714:Flnb UTSW 14 7929073 missense probably damaging 1.00
R5860:Flnb UTSW 14 7931135 missense probably damaging 1.00
R5892:Flnb UTSW 14 7907183 missense probably damaging 1.00
R5924:Flnb UTSW 14 7890765 missense probably benign 0.00
R6131:Flnb UTSW 14 7894635 missense possibly damaging 0.79
R6244:Flnb UTSW 14 7892092 missense probably damaging 1.00
R6489:Flnb UTSW 14 7867551 missense probably damaging 1.00
R6582:Flnb UTSW 14 7892275 critical splice donor site probably null
R6586:Flnb UTSW 14 7929138 missense possibly damaging 0.93
R6611:Flnb UTSW 14 7915318 missense probably damaging 1.00
R6626:Flnb UTSW 14 7929012 missense probably damaging 1.00
R6700:Flnb UTSW 14 7892189 missense probably damaging 0.99
R6738:Flnb UTSW 14 7904536 missense probably benign 0.01
R6864:Flnb UTSW 14 7905640 missense possibly damaging 0.84
R6916:Flnb UTSW 14 7907171 missense probably damaging 0.99
R7117:Flnb UTSW 14 7894214 missense probably benign 0.02
R7164:Flnb UTSW 14 7915944 splice site probably null
R7328:Flnb UTSW 14 7883788 missense possibly damaging 0.95
R7328:Flnb UTSW 14 7894660 nonsense probably null
R7687:Flnb UTSW 14 7924224 missense probably damaging 1.00
R7716:Flnb UTSW 14 7917274 missense possibly damaging 0.64
R7763:Flnb UTSW 14 7926478 missense probably benign 0.00
R7821:Flnb UTSW 14 7939113 missense probably benign 0.00
R7921:Flnb UTSW 14 7933800 missense possibly damaging 0.57
R8008:Flnb UTSW 14 7892155 missense probably damaging 1.00
R8075:Flnb UTSW 14 7913048 missense probably benign 0.00
R8084:Flnb UTSW 14 7907243 missense probably benign 0.00
R8259:Flnb UTSW 14 7889183 missense probably damaging 0.99
R8441:Flnb UTSW 14 7896488 missense probably benign 0.15
R8493:Flnb UTSW 14 7869822 missense probably damaging 0.97
R8508:Flnb UTSW 14 7950394 missense probably damaging 0.98
R8531:Flnb UTSW 14 7929939 missense probably damaging 1.00
R8812:Flnb UTSW 14 7887624 missense probably benign 0.06
R8814:Flnb UTSW 14 7927409 missense probably damaging 1.00
R8825:Flnb UTSW 14 7887566 missense probably damaging 1.00
R8868:Flnb UTSW 14 7908671 missense probably benign 0.02
R8955:Flnb UTSW 14 7892874 missense probably damaging 1.00
R8955:Flnb UTSW 14 7904688 nonsense probably null
X0066:Flnb UTSW 14 7908636 missense probably damaging 1.00
Z1088:Flnb UTSW 14 7905871 missense probably benign 0.04
Z1176:Flnb UTSW 14 7942066 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TGTTGCCATCCACCATTGGG -3'
(R):5'- TTCTCAATCAGGGACAAGAGTG -3'

Sequencing Primer
(F):5'- CCATTGGGTATACAATCCCGAGG -3'
(R):5'- CAATCAGGGACAAGAGTGAAGATATG -3'
Posted On2016-08-04