Incidental Mutation 'R5395:Gdnf'
ID 426156
Institutional Source Beutler Lab
Gene Symbol Gdnf
Ensembl Gene ENSMUSG00000022144
Gene Name glial cell line derived neurotrophic factor
Synonyms glial cell line-derived neurotrophic factor
MMRRC Submission 042967-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.937) question?
Stock # R5395 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 7840327-7867056 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 7864165 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 192 (L192Q)
Ref Sequence ENSEMBL: ENSMUSP00000022744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022744]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000022744
AA Change: L192Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022744
Gene: ENSMUSG00000022144
AA Change: L192Q

DomainStartEndE-ValueType
low complexity region 133 146 N/A INTRINSIC
TGFB 147 240 4.36e-3 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The recombinant form of this protein, a highly conserved neurotrophic factor, was shown to promote the survival and differentiation of dopaminergic neurons in culture, and was able to prevent apoptosis of motor neurons induced by axotomy. This protein is a ligand for the product of the RET (rearranged during transfection) protooncogene. Homozygous knockout mice for this gene exhibit defects in kidney development and neonatal death. This gene encodes multiple protein isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to lack of ureteric bud induction, bilateral renal agenesis, absence of enteric neurons, and neonatal death. Heterozygotes show renal phenotypes ranging from two small kidneys, often with abnormal shapes and cortical cysts, to unilateral renal agenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,874,590 (GRCm39) I268V probably benign Het
Actn1 T A 12: 80,217,477 (GRCm39) I782F probably benign Het
Adamdec1 A C 14: 68,808,352 (GRCm39) S333A probably benign Het
Agbl5 C A 5: 31,047,682 (GRCm39) T58N probably damaging Het
Apoo-ps T A 13: 107,550,993 (GRCm39) noncoding transcript Het
Arhgef10l T C 4: 140,297,601 (GRCm39) N277S probably benign Het
Ascc2 A G 11: 4,609,273 (GRCm39) E241G possibly damaging Het
Atp13a4 A T 16: 29,239,706 (GRCm39) Y835* probably null Het
Atp13a4 A G 16: 29,275,422 (GRCm39) V354A possibly damaging Het
Bcas3 T C 11: 85,716,075 (GRCm39) S426P probably damaging Het
Birc2 T C 9: 7,861,175 (GRCm39) R48G probably damaging Het
Cacna2d4 T C 6: 119,248,379 (GRCm39) S397P possibly damaging Het
Ccng2 T C 5: 93,417,257 (GRCm39) M91T possibly damaging Het
Clk3 G A 9: 57,660,622 (GRCm39) T473M probably damaging Het
Cog2 T A 8: 125,271,960 (GRCm39) H491Q probably benign Het
Cyp4f40 C T 17: 32,888,827 (GRCm39) T202I probably benign Het
Dennd1a A T 2: 37,692,140 (GRCm39) F181I probably damaging Het
Fcrl6 G T 1: 172,426,287 (GRCm39) A170D possibly damaging Het
Fev T C 1: 74,921,823 (GRCm39) probably null Het
Flnb A G 14: 7,883,881 (GRCm38) N369S probably benign Het
Flt3 A G 5: 147,291,633 (GRCm39) F606L probably damaging Het
Gdf9 T C 11: 53,324,624 (GRCm39) V131A probably benign Het
Gjc2 A T 11: 59,068,315 (GRCm39) C56S possibly damaging Het
Gli3 T C 13: 15,889,535 (GRCm39) F550L probably damaging Het
Gm1110 T C 9: 26,800,928 (GRCm39) E422G probably benign Het
Gm14325 G A 2: 177,474,777 (GRCm39) H102Y possibly damaging Het
Gnb2 A G 5: 137,526,788 (GRCm39) S334P probably damaging Het
Icam2 A T 11: 106,273,299 (GRCm39) probably null Het
Inca1 C T 11: 70,581,264 (GRCm39) probably null Het
Itgb8 A C 12: 119,134,476 (GRCm39) C530W probably damaging Het
Lrp1 T C 10: 127,431,166 (GRCm39) D332G probably damaging Het
Ly75 A T 2: 60,195,455 (GRCm39) N234K probably benign Het
Mcm5 G A 8: 75,849,654 (GRCm39) S542N probably benign Het
Mcm9 A T 10: 53,414,788 (GRCm39) N97K possibly damaging Het
Morc2a G A 11: 3,638,232 (GRCm39) R986H possibly damaging Het
Neu2 T A 1: 87,524,397 (GRCm39) probably null Het
Nfatc1 G A 18: 80,679,235 (GRCm39) P718S possibly damaging Het
Nol6 G A 4: 41,118,392 (GRCm39) probably benign Het
Or10j7 A T 1: 173,011,247 (GRCm39) Y251* probably null Het
Otogl T C 10: 107,652,999 (GRCm39) N1118D probably benign Het
Pcdh15 T A 10: 74,021,119 (GRCm39) I111K probably damaging Het
Phkb A G 8: 86,744,097 (GRCm39) D582G probably damaging Het
Piwil2 G T 14: 70,632,846 (GRCm39) N575K probably benign Het
Pou4f2 T A 8: 79,161,701 (GRCm39) I301F probably damaging Het
Prkd1 T C 12: 50,438,215 (GRCm39) N409S probably damaging Het
Ptpn21 T G 12: 98,681,376 (GRCm39) K86T probably damaging Het
Raly T A 2: 154,705,927 (GRCm39) probably null Het
Rangap1 A G 15: 81,590,647 (GRCm39) F482L probably benign Het
Rapgef1 T A 2: 29,627,977 (GRCm39) N1052K probably damaging Het
Rnf169 A T 7: 99,584,367 (GRCm39) probably null Het
Sdr16c5 T C 4: 4,016,277 (GRCm39) S50G probably benign Het
Sin3a G A 9: 57,012,957 (GRCm39) R612H probably damaging Het
Six6 T A 12: 72,988,475 (GRCm39) L216* probably null Het
Slc20a1 A T 2: 129,050,257 (GRCm39) N472Y probably damaging Het
Slc35d1 C T 4: 103,068,572 (GRCm39) probably null Het
Slc45a2 C T 15: 11,027,871 (GRCm39) T480I probably damaging Het
Slc7a8 C A 14: 54,970,734 (GRCm39) G306* probably null Het
Slc9a8 T A 2: 167,309,642 (GRCm39) F335L probably damaging Het
Smyd1 T G 6: 71,196,374 (GRCm39) K338T possibly damaging Het
Snd1 T A 6: 28,526,183 (GRCm39) V187E probably damaging Het
Spag9 T G 11: 93,982,577 (GRCm39) probably null Het
Tnfsf9 C A 17: 57,412,592 (GRCm39) T54K probably benign Het
Trim24 T G 6: 37,934,679 (GRCm39) V798G probably damaging Het
Tyr C A 7: 87,121,698 (GRCm39) A365S probably damaging Het
Usp43 T A 11: 67,788,184 (GRCm39) probably null Het
Vmn2r55 T C 7: 12,385,874 (GRCm39) D702G probably damaging Het
Vmn2r72 A G 7: 85,400,105 (GRCm39) S315P possibly damaging Het
Wdr64 T A 1: 175,583,164 (GRCm39) F367I probably damaging Het
Zc3h7b G A 15: 81,656,702 (GRCm39) R173K possibly damaging Het
Zfp493 T A 13: 67,931,965 (GRCm39) C21* probably null Het
Zfp825 T C 13: 74,628,665 (GRCm39) T284A possibly damaging Het
Zpbp2 T A 11: 98,449,039 (GRCm39) V275D probably damaging Het
Other mutations in Gdnf
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4377001:Gdnf UTSW 15 7,864,011 (GRCm39) missense probably benign 0.36
R1566:Gdnf UTSW 15 7,863,895 (GRCm39) missense probably benign 0.01
R1670:Gdnf UTSW 15 7,845,130 (GRCm39) missense probably benign 0.01
R2915:Gdnf UTSW 15 7,845,130 (GRCm39) missense possibly damaging 0.93
R8152:Gdnf UTSW 15 7,864,243 (GRCm39) missense probably damaging 1.00
R8374:Gdnf UTSW 15 7,864,176 (GRCm39) missense probably benign 0.37
R8439:Gdnf UTSW 15 7,864,134 (GRCm39) nonsense probably null
R8491:Gdnf UTSW 15 7,864,272 (GRCm39) missense possibly damaging 0.67
R9492:Gdnf UTSW 15 7,840,423 (GRCm39) start gained probably benign
X0027:Gdnf UTSW 15 7,864,147 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCCCAGAGAATTCCAGAG -3'
(R):5'- GGGCAAACATTTCCTGGGAAC -3'

Sequencing Primer
(F):5'- TCCAGAGGGAAAGGTCGC -3'
(R):5'- CTTCGCACTGTAGCAGGAATG -3'
Posted On 2016-08-04