Incidental Mutation 'R4708:Abcb4'
ID426166
Institutional Source Beutler Lab
Gene Symbol Abcb4
Ensembl Gene ENSMUSG00000042476
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 4
SynonymsPgy-2, Mdr2, Pgy2, mdr-2
MMRRC Submission 042017-MU
Accession Numbers

Ncbi RefSeq: NM_008830; MGI: 97569

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4708 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location8893717-8959231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8915125 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 332 (T332S)
Ref Sequence ENSEMBL: ENSMUSP00000142425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003717] [ENSMUST00000196067]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003717
AA Change: T332S

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003717
Gene: ENSMUSG00000042476
AA Change: T332S

DomainStartEndE-ValueType
Pfam:ABC_membrane 54 342 2e-94 PFAM
AAA 418 610 3.97e-20 SMART
Pfam:ABC_membrane 708 982 6.3e-77 PFAM
AAA 1058 1246 4.49e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000196067
AA Change: T332S

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142425
Gene: ENSMUSG00000042476
AA Change: T332S

DomainStartEndE-ValueType
Pfam:ABC_membrane 54 344 2.4e-95 PFAM
AAA 418 610 6.2e-22 SMART
Pfam:ABC_membrane 708 882 1.6e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199413
Meta Mutation Damage Score 0.1599 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 97% (68/70)
MGI Phenotype Strain: 1857236
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a full transporter and member of the p-glycoprotein family of membrane proteins with phosphatidylcholine as its substrate. The function of this protein has not yet been determined; however, it may involve transport of phospholipids from liver hepatocytes into bile. Alternative splicing of this gene results in several products of undetermined function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are unable to secrete phospholipids into bile, leading to progressive hepatic disease, with an end stage of 3 months. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,611,885 G2D probably damaging Het
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
4930505A04Rik T C 11: 30,454,717 Y62C probably damaging Het
4931408C20Rik A T 1: 26,684,440 V553D possibly damaging Het
Aadacl4 A C 4: 144,623,329 K385N probably benign Het
Aco2 G A 15: 81,909,916 probably null Het
Aplf G T 6: 87,663,757 S69Y probably damaging Het
Arhgap27 A G 11: 103,333,562 probably benign Het
B4galnt1 T A 10: 127,169,815 Y262N probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
BC017158 A G 7: 128,274,680 V345A probably benign Het
Ccdc62 T G 5: 123,930,862 probably null Het
Cd109 T A 9: 78,672,589 I649K probably benign Het
Cd209b T C 8: 3,924,215 E99G probably damaging Het
Cep290 A G 10: 100,523,264 K952R probably benign Het
Ces2a A G 8: 104,737,306 H190R probably benign Het
Clec14a A G 12: 58,267,703 S378P probably benign Het
Col27a1 A G 4: 63,283,913 Q947R probably benign Het
Dennd3 A G 15: 73,523,495 T146A probably damaging Het
Dpy19l4 T A 4: 11,277,970 M486L probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Eif4enif1 T G 11: 3,220,323 H125Q probably damaging Het
Fam35a A G 14: 34,267,833 V372A probably benign Het
Fcgbp A T 7: 28,094,961 M1197L probably benign Het
Fubp3 C T 2: 31,608,110 T92I probably benign Het
Gm19426 T C 2: 84,743,459 probably null Het
Gtf2ird2 A G 5: 134,216,298 H466R probably damaging Het
Hdac5 T C 11: 102,202,193 S573G probably damaging Het
Iars2 A T 1: 185,289,357 M916K probably benign Het
Insr A T 8: 3,211,346 probably benign Het
Itgam T C 7: 128,101,537 V493A probably damaging Het
Ivl T A 3: 92,571,750 K336I probably damaging Het
Kcng2 A G 18: 80,322,852 I95T probably damaging Het
Lap3 A G 5: 45,511,138 R431G probably damaging Het
Lrrc66 T C 5: 73,629,662 H115R probably benign Het
Morc3 T C 16: 93,873,238 V767A probably benign Het
Mttp A G 3: 138,134,098 probably benign Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nat9 G A 11: 115,183,443 T133M probably damaging Het
Nectin4 T C 1: 171,385,146 I349T probably benign Het
Nlrp4a A G 7: 26,464,108 E900G probably benign Het
Nlrp9c A T 7: 26,384,840 M438K probably benign Het
Olfr1384 T A 11: 49,514,389 Y250* probably null Het
Olfr1444 A T 19: 12,861,897 I41F probably benign Het
Olfr551 A T 7: 102,587,836 D302E probably benign Het
Parp6 T C 9: 59,641,769 I507T probably damaging Het
Pde6c G A 19: 38,180,893 E804K possibly damaging Het
Plscr2 A G 9: 92,291,014 Y203C probably damaging Het
Ptprs A G 17: 56,428,067 W216R probably damaging Het
Rhof T A 5: 123,120,391 T126S probably benign Het
Riox2 A G 16: 59,475,682 I49V probably benign Het
Tmc6 A T 11: 117,768,948 C750S probably benign Het
Tmem231 C A 8: 111,933,786 probably benign Het
Tmem94 T A 11: 115,786,295 I131N possibly damaging Het
Tmx3 T C 18: 90,521,039 probably null Het
Tnfrsf21 C T 17: 43,038,232 T245I possibly damaging Het
Ttbk2 C A 2: 120,739,861 R1201S probably damaging Het
Vmn2r102 A T 17: 19,694,314 M714L probably benign Het
Vmn2r109 A G 17: 20,541,343 L584S probably damaging Het
Vmn2r53 T A 7: 12,601,202 H177L probably benign Het
Vnn1 T A 10: 23,897,352 D92E probably benign Het
Zan T C 5: 137,446,712 I1762V unknown Het
Zbtb20 G T 16: 43,610,676 A517S probably damaging Het
Zfhx4 A G 3: 5,245,503 probably null Het
Zfp560 T C 9: 20,351,918 E54G possibly damaging Het
Zfp719 C T 7: 43,590,232 H415Y probably damaging Het
Zmynd11 A C 13: 9,695,753 V188G probably damaging Het
Other mutations in Abcb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Abcb4 APN 5 8950073 missense probably benign 0.02
IGL00663:Abcb4 APN 5 8927916 missense probably damaging 1.00
IGL00671:Abcb4 APN 5 8930745 nonsense probably null
IGL00822:Abcb4 APN 5 8950046 missense probably benign
IGL01080:Abcb4 APN 5 8934258 missense probably damaging 1.00
IGL01152:Abcb4 APN 5 8950678 missense probably benign 0.19
IGL01329:Abcb4 APN 5 8894166 critical splice donor site probably null
IGL01483:Abcb4 APN 5 8927871 missense probably damaging 0.99
IGL01594:Abcb4 APN 5 8946071 unclassified probably null
IGL01785:Abcb4 APN 5 8915058 nonsense probably null
IGL01968:Abcb4 APN 5 8927913 missense probably benign 0.33
IGL02579:Abcb4 APN 5 8955537 missense probably damaging 1.00
IGL02654:Abcb4 APN 5 8927826 missense possibly damaging 0.80
IGL02658:Abcb4 APN 5 8934240 missense probably benign
IGL03229:Abcb4 APN 5 8940936 missense probably damaging 0.97
IGL03335:Abcb4 APN 5 8935258 missense probably benign 0.00
FR4737:Abcb4 UTSW 5 8896597 small deletion probably benign
P0014:Abcb4 UTSW 5 8950083 missense probably benign 0.01
R0102:Abcb4 UTSW 5 8909194 missense probably damaging 0.99
R0102:Abcb4 UTSW 5 8909194 missense probably damaging 0.99
R0309:Abcb4 UTSW 5 8939835 missense probably damaging 1.00
R0311:Abcb4 UTSW 5 8934243 missense probably benign
R0420:Abcb4 UTSW 5 8941050 missense probably benign 0.03
R0449:Abcb4 UTSW 5 8939885 nonsense probably null
R0609:Abcb4 UTSW 5 8947376 missense probably damaging 0.96
R1459:Abcb4 UTSW 5 8918662 missense possibly damaging 0.61
R1470:Abcb4 UTSW 5 8940968 missense probably damaging 0.98
R1470:Abcb4 UTSW 5 8940968 missense probably damaging 0.98
R1812:Abcb4 UTSW 5 8928578 critical splice donor site probably null
R1944:Abcb4 UTSW 5 8930796 missense probably damaging 1.00
R2002:Abcb4 UTSW 5 8905989 missense probably benign 0.01
R2256:Abcb4 UTSW 5 8958431 missense probably damaging 1.00
R3116:Abcb4 UTSW 5 8896610 missense possibly damaging 0.86
R4112:Abcb4 UTSW 5 8936783 critical splice acceptor site probably null
R4354:Abcb4 UTSW 5 8918771 missense probably benign 0.44
R4512:Abcb4 UTSW 5 8928573 missense probably damaging 1.00
R4588:Abcb4 UTSW 5 8947328 missense probably benign 0.01
R4628:Abcb4 UTSW 5 8907399 missense probably benign 0.08
R4714:Abcb4 UTSW 5 8930906 splice site probably null
R4754:Abcb4 UTSW 5 8910717 missense probably damaging 1.00
R4846:Abcb4 UTSW 5 8935180 missense probably benign
R4896:Abcb4 UTSW 5 8907267 missense possibly damaging 0.81
R4944:Abcb4 UTSW 5 8934327 critical splice donor site probably null
R4994:Abcb4 UTSW 5 8928524 missense probably damaging 1.00
R5022:Abcb4 UTSW 5 8909054 intron probably null
R5537:Abcb4 UTSW 5 8955485 missense probably damaging 0.98
R5754:Abcb4 UTSW 5 8934320 missense probably benign
R5833:Abcb4 UTSW 5 8958314 missense probably damaging 1.00
R5934:Abcb4 UTSW 5 8930806 missense probably benign 0.18
R6006:Abcb4 UTSW 5 8946026 missense probably damaging 0.99
R6146:Abcb4 UTSW 5 8896587 missense probably benign 0.05
R6183:Abcb4 UTSW 5 8918718 missense probably benign
R6260:Abcb4 UTSW 5 8934219 nonsense probably null
R6561:Abcb4 UTSW 5 8927825 missense probably benign 0.14
R7016:Abcb4 UTSW 5 8936843 missense probably benign 0.35
R7081:Abcb4 UTSW 5 8934263 missense probably benign
R7326:Abcb4 UTSW 5 8934226 missense probably benign 0.00
R7375:Abcb4 UTSW 5 8918671 missense probably benign
R7787:Abcb4 UTSW 5 8909220 missense probably damaging 1.00
RF015:Abcb4 UTSW 5 8896594 frame shift probably null
RF047:Abcb4 UTSW 5 8896595 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CATACTGAATAGGGGTTTATTACGC -3'
(R):5'- TTCCATAACTCCAACTCCAGGG -3'

Sequencing Primer
(F):5'- CCTTGGGTTGTAAAGTGTTATTCAC -3'
(R):5'- AACTCCAGGGGGATCCTAC -3'
Posted On2016-08-16