Incidental Mutation 'R4708:Morc3'
ID426169
Institutional Source Beutler Lab
Gene Symbol Morc3
Ensembl Gene ENSMUSG00000039456
Gene Namemicrorchidia 3
SynonymsZcwcc3, 1110051N18Rik, 1110051N18Rik, D16Jhu32e
MMRRC Submission 042017-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4708 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location93832121-93876073 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93873238 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 767 (V767A)
Ref Sequence ENSEMBL: ENSMUSP00000144058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044068] [ENSMUST00000201097] [ENSMUST00000202261]
Predicted Effect probably benign
Transcript: ENSMUST00000044068
AA Change: V840A

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000040152
Gene: ENSMUSG00000039456
AA Change: V840A

DomainStartEndE-ValueType
Pfam:HATPase_c 25 130 8e-8 PFAM
Pfam:HATPase_c_3 26 164 1.1e-18 PFAM
Pfam:zf-CW 409 452 2.7e-19 PFAM
low complexity region 461 472 N/A INTRINSIC
low complexity region 630 639 N/A INTRINSIC
coiled coil region 765 871 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201097
AA Change: V767A

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000144058
Gene: ENSMUSG00000039456
AA Change: V767A

DomainStartEndE-ValueType
Blast:HATPase_c 1 70 4e-39 BLAST
Pfam:zf-CW 340 383 1.2e-16 PFAM
low complexity region 392 403 N/A INTRINSIC
low complexity region 557 566 N/A INTRINSIC
coiled coil region 692 798 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202261
AA Change: V840A

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000144369
Gene: ENSMUSG00000039456
AA Change: V840A

DomainStartEndE-ValueType
Pfam:HATPase_c 25 130 8e-8 PFAM
Pfam:HATPase_c_3 26 164 1.1e-18 PFAM
Pfam:zf-CW 409 452 2.7e-19 PFAM
low complexity region 461 472 N/A INTRINSIC
low complexity region 630 639 N/A INTRINSIC
coiled coil region 765 871 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232425
Predicted Effect probably benign
Transcript: ENSMUST00000232639
Meta Mutation Damage Score 0.0695 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that localizes to the nuclear matrix and forms nuclear bodies via an ATP-dependent mechanism. The protein is predicted to have coiled-coil and zinc finger domains and has RNA binding activity. Alternative splicing produces multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a null allele die at or within a day of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,611,885 G2D probably damaging Het
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
4930505A04Rik T C 11: 30,454,717 Y62C probably damaging Het
4931408C20Rik A T 1: 26,684,440 V553D possibly damaging Het
Aadacl4 A C 4: 144,623,329 K385N probably benign Het
Abcb4 A T 5: 8,915,125 T332S possibly damaging Het
Aco2 G A 15: 81,909,916 probably null Het
Aplf G T 6: 87,663,757 S69Y probably damaging Het
Arhgap27 A G 11: 103,333,562 probably benign Het
B4galnt1 T A 10: 127,169,815 Y262N probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
BC017158 A G 7: 128,274,680 V345A probably benign Het
Ccdc62 T G 5: 123,930,862 probably null Het
Cd109 T A 9: 78,672,589 I649K probably benign Het
Cd209b T C 8: 3,924,215 E99G probably damaging Het
Cep290 A G 10: 100,523,264 K952R probably benign Het
Ces2a A G 8: 104,737,306 H190R probably benign Het
Clec14a A G 12: 58,267,703 S378P probably benign Het
Col27a1 A G 4: 63,283,913 Q947R probably benign Het
Dennd3 A G 15: 73,523,495 T146A probably damaging Het
Dpy19l4 T A 4: 11,277,970 M486L probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Eif4enif1 T G 11: 3,220,323 H125Q probably damaging Het
Fam35a A G 14: 34,267,833 V372A probably benign Het
Fcgbp A T 7: 28,094,961 M1197L probably benign Het
Fubp3 C T 2: 31,608,110 T92I probably benign Het
Gm19426 T C 2: 84,743,459 probably null Het
Gtf2ird2 A G 5: 134,216,298 H466R probably damaging Het
Hdac5 T C 11: 102,202,193 S573G probably damaging Het
Iars2 A T 1: 185,289,357 M916K probably benign Het
Insr A T 8: 3,211,346 probably benign Het
Itgam T C 7: 128,101,537 V493A probably damaging Het
Ivl T A 3: 92,571,750 K336I probably damaging Het
Kcng2 A G 18: 80,322,852 I95T probably damaging Het
Lap3 A G 5: 45,511,138 R431G probably damaging Het
Lrrc66 T C 5: 73,629,662 H115R probably benign Het
Mttp A G 3: 138,134,098 probably benign Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nat9 G A 11: 115,183,443 T133M probably damaging Het
Nectin4 T C 1: 171,385,146 I349T probably benign Het
Nlrp4a A G 7: 26,464,108 E900G probably benign Het
Nlrp9c A T 7: 26,384,840 M438K probably benign Het
Olfr1384 T A 11: 49,514,389 Y250* probably null Het
Olfr1444 A T 19: 12,861,897 I41F probably benign Het
Olfr551 A T 7: 102,587,836 D302E probably benign Het
Parp6 T C 9: 59,641,769 I507T probably damaging Het
Pde6c G A 19: 38,180,893 E804K possibly damaging Het
Plscr2 A G 9: 92,291,014 Y203C probably damaging Het
Ptprs A G 17: 56,428,067 W216R probably damaging Het
Rhof T A 5: 123,120,391 T126S probably benign Het
Riox2 A G 16: 59,475,682 I49V probably benign Het
Tmc6 A T 11: 117,768,948 C750S probably benign Het
Tmem231 C A 8: 111,933,786 probably benign Het
Tmem94 T A 11: 115,786,295 I131N possibly damaging Het
Tmx3 T C 18: 90,521,039 probably null Het
Tnfrsf21 C T 17: 43,038,232 T245I possibly damaging Het
Ttbk2 C A 2: 120,739,861 R1201S probably damaging Het
Vmn2r102 A T 17: 19,694,314 M714L probably benign Het
Vmn2r109 A G 17: 20,541,343 L584S probably damaging Het
Vmn2r53 T A 7: 12,601,202 H177L probably benign Het
Vnn1 T A 10: 23,897,352 D92E probably benign Het
Zan T C 5: 137,446,712 I1762V unknown Het
Zbtb20 G T 16: 43,610,676 A517S probably damaging Het
Zfhx4 A G 3: 5,245,503 probably null Het
Zfp560 T C 9: 20,351,918 E54G possibly damaging Het
Zfp719 C T 7: 43,590,232 H415Y probably damaging Het
Zmynd11 A C 13: 9,695,753 V188G probably damaging Het
Other mutations in Morc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Morc3 APN 16 93873395 critical splice donor site probably null
IGL01015:Morc3 APN 16 93862646 missense probably damaging 1.00
IGL01374:Morc3 APN 16 93844213 missense probably damaging 1.00
IGL01634:Morc3 APN 16 93873237 missense probably benign 0.02
IGL01845:Morc3 APN 16 93860567 missense probably damaging 0.96
IGL02202:Morc3 APN 16 93870861 missense probably benign 0.01
IGL02478:Morc3 APN 16 93864956 splice site probably benign
IGL03026:Morc3 APN 16 93862724 splice site probably benign
IGL03115:Morc3 APN 16 93871083 missense probably damaging 0.99
Ballista UTSW 16 93841383 missense probably damaging 1.00
mindy UTSW 16 93866533 missense probably benign 0.03
pfaff UTSW 16 93862684 missense probably damaging 0.96
shield UTSW 16 93874812 missense probably damaging 0.98
sparkle UTSW 16 93870474 missense probably damaging 1.00
Stooges UTSW 16 93841387 missense probably damaging 1.00
Sword UTSW 16 93874757 critical splice acceptor site probably null
R0173:Morc3 UTSW 16 93832206 splice site probably null
R0413:Morc3 UTSW 16 93870474 missense probably damaging 1.00
R0639:Morc3 UTSW 16 93853850 missense probably damaging 1.00
R0842:Morc3 UTSW 16 93873396 critical splice donor site probably null
R1134:Morc3 UTSW 16 93870669 missense probably benign
R1162:Morc3 UTSW 16 93853108 missense probably damaging 1.00
R1498:Morc3 UTSW 16 93853855 missense probably damaging 1.00
R1520:Morc3 UTSW 16 93844241 missense probably damaging 0.96
R1603:Morc3 UTSW 16 93866503 missense probably benign
R1622:Morc3 UTSW 16 93874806 missense probably benign 0.28
R1630:Morc3 UTSW 16 93866533 missense probably benign 0.03
R1818:Morc3 UTSW 16 93855510 missense probably damaging 1.00
R1902:Morc3 UTSW 16 93870497 missense probably damaging 1.00
R2090:Morc3 UTSW 16 93866453 missense probably benign 0.23
R2261:Morc3 UTSW 16 93853221 splice site probably benign
R2360:Morc3 UTSW 16 93841387 missense probably damaging 1.00
R2407:Morc3 UTSW 16 93844327 critical splice donor site probably null
R2519:Morc3 UTSW 16 93862539 splice site probably null
R3736:Morc3 UTSW 16 93874812 missense probably damaging 0.98
R3873:Morc3 UTSW 16 93862436 missense probably damaging 0.99
R4114:Morc3 UTSW 16 93873339 missense probably benign 0.01
R4115:Morc3 UTSW 16 93873339 missense probably benign 0.01
R4116:Morc3 UTSW 16 93873339 missense probably benign 0.01
R4472:Morc3 UTSW 16 93874757 critical splice acceptor site probably null
R4609:Morc3 UTSW 16 93864968 missense probably benign 0.01
R4883:Morc3 UTSW 16 93870362 critical splice acceptor site probably null
R4945:Morc3 UTSW 16 93871194 missense probably damaging 1.00
R4965:Morc3 UTSW 16 93860587 nonsense probably null
R5399:Morc3 UTSW 16 93862539 splice site probably null
R5481:Morc3 UTSW 16 93862655 missense probably damaging 0.99
R5540:Morc3 UTSW 16 93847380 missense probably benign
R5970:Morc3 UTSW 16 93866453 missense possibly damaging 0.65
R6006:Morc3 UTSW 16 93866493 missense possibly damaging 0.67
R6044:Morc3 UTSW 16 93866442 missense probably benign 0.02
R6045:Morc3 UTSW 16 93874845 missense probably damaging 1.00
R6155:Morc3 UTSW 16 93862425 missense possibly damaging 0.94
R6165:Morc3 UTSW 16 93841383 missense probably damaging 1.00
R6225:Morc3 UTSW 16 93845194 nonsense probably null
R6240:Morc3 UTSW 16 93862684 missense probably damaging 0.96
R6835:Morc3 UTSW 16 93847421 missense probably damaging 1.00
R6918:Morc3 UTSW 16 93853135 missense probably benign 0.36
R6944:Morc3 UTSW 16 93870572 missense probably benign
R7311:Morc3 UTSW 16 93849173 missense probably damaging 1.00
R7398:Morc3 UTSW 16 93874860 missense probably damaging 1.00
R7553:Morc3 UTSW 16 93870936 missense probably damaging 0.98
R8056:Morc3 UTSW 16 93845176 missense probably benign 0.07
R8299:Morc3 UTSW 16 93853200 missense probably damaging 1.00
R8317:Morc3 UTSW 16 93862529 missense probably benign 0.25
X0023:Morc3 UTSW 16 93847399 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCACTGGTAGATAGGCCTAC -3'
(R):5'- TACTGAGCATGTGTGAACCCC -3'

Sequencing Primer
(F):5'- GTAGATAGGCCTACCCAGCAAG -3'
(R):5'- TGTGTGAACCCCCTGCAAAAAC -3'
Posted On2016-08-16