Incidental Mutation 'R4708:Kcng2'
ID426171
Institutional Source Beutler Lab
Gene Symbol Kcng2
Ensembl Gene ENSMUSG00000059852
Gene Namepotassium voltage-gated channel, subfamily G, member 2
Synonyms
MMRRC Submission 042017-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4708 (G1)
Quality Score61
Status Validated
Chromosome18
Chromosomal Location80294546-80364254 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80322852 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 95 (I95T)
Ref Sequence ENSEMBL: ENSMUSP00000139072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077962] [ENSMUST00000184366] [ENSMUST00000184574]
Predicted Effect probably damaging
Transcript: ENSMUST00000077962
AA Change: I95T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000077112
Gene: ENSMUSG00000059852
AA Change: I95T

DomainStartEndE-ValueType
BTB 31 139 9.55e-4 SMART
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Ion_trans 233 417 7.1e-27 PFAM
Pfam:Ion_trans_2 336 423 3.5e-15 PFAM
low complexity region 445 458 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181877
Predicted Effect probably benign
Transcript: ENSMUST00000184366
SMART Domains Protein: ENSMUSP00000138920
Gene: ENSMUSG00000059852

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
Blast:BTB 32 64 2e-14 BLAST
SCOP:d1t1da_ 33 63 7e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184574
AA Change: I95T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139072
Gene: ENSMUSG00000059852
AA Change: I95T

DomainStartEndE-ValueType
BTB 31 139 9.55e-4 SMART
Meta Mutation Damage Score 0.6854 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily G. This member is a gamma subunit of the voltage-gated potassium channel. The delayed-rectifier type channels containing this subunit may contribute to cardiac action potential repolarization. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,611,885 G2D probably damaging Het
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
4930505A04Rik T C 11: 30,454,717 Y62C probably damaging Het
4931408C20Rik A T 1: 26,684,440 V553D possibly damaging Het
Aadacl4 A C 4: 144,623,329 K385N probably benign Het
Abcb4 A T 5: 8,915,125 T332S possibly damaging Het
Aco2 G A 15: 81,909,916 probably null Het
Aplf G T 6: 87,663,757 S69Y probably damaging Het
Arhgap27 A G 11: 103,333,562 probably benign Het
B4galnt1 T A 10: 127,169,815 Y262N probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
BC017158 A G 7: 128,274,680 V345A probably benign Het
Ccdc62 T G 5: 123,930,862 probably null Het
Cd109 T A 9: 78,672,589 I649K probably benign Het
Cd209b T C 8: 3,924,215 E99G probably damaging Het
Cep290 A G 10: 100,523,264 K952R probably benign Het
Ces2a A G 8: 104,737,306 H190R probably benign Het
Clec14a A G 12: 58,267,703 S378P probably benign Het
Col27a1 A G 4: 63,283,913 Q947R probably benign Het
Dennd3 A G 15: 73,523,495 T146A probably damaging Het
Dpy19l4 T A 4: 11,277,970 M486L probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Eif4enif1 T G 11: 3,220,323 H125Q probably damaging Het
Fam35a A G 14: 34,267,833 V372A probably benign Het
Fcgbp A T 7: 28,094,961 M1197L probably benign Het
Fubp3 C T 2: 31,608,110 T92I probably benign Het
Gm19426 T C 2: 84,743,459 probably null Het
Gtf2ird2 A G 5: 134,216,298 H466R probably damaging Het
Hdac5 T C 11: 102,202,193 S573G probably damaging Het
Iars2 A T 1: 185,289,357 M916K probably benign Het
Insr A T 8: 3,211,346 probably benign Het
Itgam T C 7: 128,101,537 V493A probably damaging Het
Ivl T A 3: 92,571,750 K336I probably damaging Het
Lap3 A G 5: 45,511,138 R431G probably damaging Het
Lrrc66 T C 5: 73,629,662 H115R probably benign Het
Morc3 T C 16: 93,873,238 V767A probably benign Het
Mttp A G 3: 138,134,098 probably benign Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nat9 G A 11: 115,183,443 T133M probably damaging Het
Nectin4 T C 1: 171,385,146 I349T probably benign Het
Nlrp4a A G 7: 26,464,108 E900G probably benign Het
Nlrp9c A T 7: 26,384,840 M438K probably benign Het
Olfr1384 T A 11: 49,514,389 Y250* probably null Het
Olfr1444 A T 19: 12,861,897 I41F probably benign Het
Olfr551 A T 7: 102,587,836 D302E probably benign Het
Parp6 T C 9: 59,641,769 I507T probably damaging Het
Pde6c G A 19: 38,180,893 E804K possibly damaging Het
Plscr2 A G 9: 92,291,014 Y203C probably damaging Het
Ptprs A G 17: 56,428,067 W216R probably damaging Het
Rhof T A 5: 123,120,391 T126S probably benign Het
Riox2 A G 16: 59,475,682 I49V probably benign Het
Tmc6 A T 11: 117,768,948 C750S probably benign Het
Tmem231 C A 8: 111,933,786 probably benign Het
Tmem94 T A 11: 115,786,295 I131N possibly damaging Het
Tmx3 T C 18: 90,521,039 probably null Het
Tnfrsf21 C T 17: 43,038,232 T245I possibly damaging Het
Ttbk2 C A 2: 120,739,861 R1201S probably damaging Het
Vmn2r102 A T 17: 19,694,314 M714L probably benign Het
Vmn2r109 A G 17: 20,541,343 L584S probably damaging Het
Vmn2r53 T A 7: 12,601,202 H177L probably benign Het
Vnn1 T A 10: 23,897,352 D92E probably benign Het
Zan T C 5: 137,446,712 I1762V unknown Het
Zbtb20 G T 16: 43,610,676 A517S probably damaging Het
Zfhx4 A G 3: 5,245,503 probably null Het
Zfp560 T C 9: 20,351,918 E54G possibly damaging Het
Zfp719 C T 7: 43,590,232 H415Y probably damaging Het
Zmynd11 A C 13: 9,695,753 V188G probably damaging Het
Other mutations in Kcng2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4510:Kcng2 UTSW 18 80295715 missense probably benign
R4511:Kcng2 UTSW 18 80295715 missense probably benign
R4870:Kcng2 UTSW 18 80322868 missense probably benign 0.03
R6996:Kcng2 UTSW 18 80323143 start gained probably benign
R7727:Kcng2 UTSW 18 80296090 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TCTACATCCCACCTAGGTGC -3'
(R):5'- GCGCCACGTCATTATCAACG -3'

Sequencing Primer
(F):5'- ACCTAGGTGCCCGATGTG -3'
(R):5'- TCATTATCAACGTCGGGGGC -3'
Posted On2016-08-16