Incidental Mutation 'R4823:Ush1c'
ID 426179
Institutional Source Beutler Lab
Gene Symbol Ush1c
Ensembl Gene ENSMUSG00000030838
Gene Name USH1 protein network component harmonin
Synonyms harmonin, Usher syndrome 1C, 2010016F01Rik
MMRRC Submission 042439-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4823 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 45844774-45887927 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 45845157 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 886 (N886I)
Ref Sequence ENSEMBL: ENSMUSP00000009667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009667] [ENSMUST00000078680] [ENSMUST00000143155] [ENSMUST00000154292] [ENSMUST00000176371] [ENSMUST00000177212] [ENSMUST00000222454]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000009667
AA Change: N886I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000009667
Gene: ENSMUSG00000030838
AA Change: N886I

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 292 5.62e-18 SMART
coiled coil region 301 376 N/A INTRINSIC
coiled coil region 419 478 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 562 596 N/A INTRINSIC
low complexity region 600 612 N/A INTRINSIC
PDZ 762 841 1.13e-13 SMART
low complexity region 846 860 N/A INTRINSIC
low complexity region 899 910 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078680
AA Change: T546S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077747
Gene: ENSMUSG00000030838
AA Change: T546S

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 292 5.62e-18 SMART
coiled coil region 301 376 N/A INTRINSIC
PDZ 458 537 1.13e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129266
Predicted Effect probably benign
Transcript: ENSMUST00000143155
SMART Domains Protein: ENSMUSP00000119676
Gene: ENSMUSG00000030838

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 292 5.62e-18 SMART
coiled coil region 301 376 N/A INTRINSIC
coiled coil region 419 478 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 562 596 N/A INTRINSIC
low complexity region 600 612 N/A INTRINSIC
PDZ 762 841 1.13e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154292
AA Change: T889S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114494
Gene: ENSMUSG00000030838
AA Change: T889S

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 292 5.62e-18 SMART
coiled coil region 301 376 N/A INTRINSIC
coiled coil region 419 478 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 562 596 N/A INTRINSIC
low complexity region 600 612 N/A INTRINSIC
PDZ 762 841 1.13e-13 SMART
low complexity region 846 860 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176371
AA Change: T515S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134783
Gene: ENSMUSG00000030838
AA Change: T515S

DomainStartEndE-ValueType
PDZ 65 137 3.06e-19 SMART
low complexity region 159 172 N/A INTRINSIC
PDZ 189 261 5.62e-18 SMART
coiled coil region 270 345 N/A INTRINSIC
PDZ 427 506 1.13e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177212
AA Change: T527S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135734
Gene: ENSMUSG00000030838
AA Change: T527S

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 291 6.13e-10 SMART
low complexity region 313 325 N/A INTRINSIC
low complexity region 339 357 N/A INTRINSIC
PDZ 439 518 1.13e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222454
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 98% (96/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein that functions in the assembly of Usher protein complexes. The protein contains PDZ domains, a coiled-coil region with a bipartite nuclear localization signal and a PEST degradation sequence. Defects in this gene are the cause of Usher syndrome type 1C and non-syndromic sensorineural deafness autosomal recessive type 18. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mutations at this locus affect hearing and result in movement anomalies generally associated with vestibular mutants, such as head tossing and circling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G A 5: 88,120,457 (GRCm39) D405N probably benign Het
4921517D22Rik T G 13: 59,838,718 (GRCm39) E38A probably damaging Het
4930433I11Rik A T 7: 40,642,786 (GRCm39) I152F probably benign Het
Aass A T 6: 23,107,690 (GRCm39) D364E probably benign Het
Adamts2 A G 11: 50,628,014 (GRCm39) D238G probably benign Het
Albfm1 T A 5: 90,714,362 (GRCm39) L124H probably benign Het
Aoc1l1 A G 6: 48,952,195 (GRCm39) D40G probably damaging Het
Aplf G A 6: 87,623,237 (GRCm39) L302F probably damaging Het
Apol7b G T 15: 77,311,982 (GRCm39) probably benign Het
Arhgef12 A G 9: 42,931,992 (GRCm39) V165A probably benign Het
Ascc3 T C 10: 50,589,329 (GRCm39) S1017P probably damaging Het
B230104I21Rik T A 4: 154,434,204 (GRCm39) probably benign Het
Bfsp2 C A 9: 103,357,082 (GRCm39) C115F probably damaging Het
Bhmt2 A T 13: 93,799,798 (GRCm39) W213R probably benign Het
Capn5 A T 7: 97,775,648 (GRCm39) V431E probably damaging Het
Ccdc88c A G 12: 100,896,802 (GRCm39) Y1390H probably damaging Het
Ccr3 A G 9: 123,828,718 (GRCm39) T18A probably damaging Het
Cdh5 T C 8: 104,869,301 (GRCm39) S676P probably benign Het
Ceacam5 A G 7: 17,491,669 (GRCm39) T680A possibly damaging Het
Cebpd G A 16: 15,705,978 (GRCm39) G264S probably benign Het
Cfd T C 10: 79,726,782 (GRCm39) V8A probably benign Het
Cops9 C T 1: 92,569,588 (GRCm39) probably benign Het
Cpne6 T C 14: 55,754,467 (GRCm39) Y533H probably damaging Het
Cyp2c67 T A 19: 39,604,168 (GRCm39) H396L probably benign Het
Cyp2j9 G A 4: 96,456,972 (GRCm39) P500S possibly damaging Het
Cyp4a12a A T 4: 115,184,610 (GRCm39) probably null Het
Dbt G A 3: 116,317,036 (GRCm39) D71N probably damaging Het
Ddx41 G T 13: 55,679,868 (GRCm39) Q440K probably benign Het
Elovl4 A G 9: 83,662,738 (GRCm39) F174S probably damaging Het
Emcn C G 3: 137,129,187 (GRCm39) P193R probably damaging Het
Etnk1 T C 6: 143,113,364 (GRCm39) probably null Het
Fads3 A C 19: 10,019,252 (GRCm39) S53R probably damaging Het
Fam193a A G 5: 34,616,372 (GRCm39) E849G probably damaging Het
Fat3 A G 9: 15,907,803 (GRCm39) V2733A probably benign Het
Frem3 T A 8: 81,340,587 (GRCm39) M960K probably benign Het
Frmd6 A T 12: 70,919,349 (GRCm39) I62L probably benign Het
Glmp T C 3: 88,232,530 (GRCm39) probably benign Het
Gm17421 T C 12: 113,333,161 (GRCm39) noncoding transcript Het
Gm27013 T A 6: 130,499,186 (GRCm39) noncoding transcript Het
Gtf2ird1 A G 5: 134,424,576 (GRCm39) V390A probably damaging Het
Hps3 A G 3: 20,066,890 (GRCm39) Y559H probably benign Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Itpr3 A G 17: 27,304,121 (GRCm39) D114G probably benign Het
Jmjd4 G A 11: 59,346,406 (GRCm39) A408T probably benign Het
Kcnh4 G T 11: 100,646,000 (GRCm39) A316D probably damaging Het
Klrg1 T A 6: 122,250,492 (GRCm39) probably null Het
Lancl2 T A 6: 57,709,262 (GRCm39) Y355N probably damaging Het
Ltb T C 17: 35,414,206 (GRCm39) S115P probably benign Het
Mccc2 T G 13: 100,136,762 (GRCm39) R64S probably benign Het
Mgam2-ps T A 6: 40,809,596 (GRCm39) noncoding transcript Het
Mrrf T G 2: 36,038,042 (GRCm39) N104K possibly damaging Het
Nipa1 C A 7: 55,629,436 (GRCm39) V226L possibly damaging Het
Numa1 T A 7: 101,645,244 (GRCm39) L290Q probably damaging Het
Ofcc1 T A 13: 40,433,949 (GRCm39) H52L probably damaging Het
Ogfod3 G A 11: 121,086,027 (GRCm39) A189V probably benign Het
Or14c39 T A 7: 86,343,796 (GRCm39) I44N probably damaging Het
Or5b21 A T 19: 12,839,180 (GRCm39) I14F probably benign Het
Or5d46 A G 2: 88,170,179 (GRCm39) D90G probably damaging Het
Or9i1b G A 19: 13,897,022 (GRCm39) V213I probably benign Het
P2ry12 G A 3: 59,125,318 (GRCm39) S119L probably benign Het
Pde7b T A 10: 20,314,531 (GRCm39) N192Y probably damaging Het
Pfkl T C 10: 77,833,428 (GRCm39) N258S probably damaging Het
Phykpl G A 11: 51,477,420 (GRCm39) A71T probably damaging Het
Ppp1r16a T C 15: 76,577,393 (GRCm39) probably benign Het
Pramel15 T C 4: 144,099,781 (GRCm39) N328S possibly damaging Het
Pramel32 T C 4: 88,547,452 (GRCm39) K160R probably damaging Het
Prune2 C T 19: 17,097,868 (GRCm39) T1124M probably damaging Het
Rapgef6 A G 11: 54,585,326 (GRCm39) I1570V probably benign Het
Rbm34 T C 8: 127,697,655 (GRCm39) S19G probably benign Het
Rnf10 T C 5: 115,393,501 (GRCm39) probably null Het
Rnf34 A G 5: 122,988,365 (GRCm39) probably null Het
Setd4 A G 16: 93,386,838 (GRCm39) S287P probably benign Het
Shc3 C T 13: 51,605,606 (GRCm39) V225I probably benign Het
Sipa1l3 C T 7: 29,070,427 (GRCm39) V1030I probably damaging Het
Siva1 G T 12: 112,611,498 (GRCm39) R33L probably damaging Het
Slc4a5 C T 6: 83,249,115 (GRCm39) T573I probably damaging Het
Sorcs1 C T 19: 50,666,578 (GRCm39) R110Q possibly damaging Het
Sorcs1 T C 19: 50,218,740 (GRCm39) I581V possibly damaging Het
Sorl1 T C 9: 41,903,617 (GRCm39) D1545G probably damaging Het
Tas2r124 T G 6: 132,732,509 (GRCm39) S273A probably damaging Het
Tcf15 T C 2: 151,985,813 (GRCm39) F90L probably damaging Het
Trim59 G A 3: 68,944,453 (GRCm39) R296C probably benign Het
Tulp1 A T 17: 28,572,546 (GRCm39) D229E probably benign Het
Usp9y A T Y: 1,444,559 (GRCm39) S127T probably damaging Het
Vmn1r19 T A 6: 57,382,219 (GRCm39) Y257* probably null Het
Vmn2r109 A T 17: 20,774,153 (GRCm39) Y401N probably damaging Het
Vmn2r69 A C 7: 85,060,508 (GRCm39) S359A probably benign Het
Zfp37 A T 4: 62,109,740 (GRCm39) N479K probably benign Het
Other mutations in Ush1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ush1c APN 7 45,846,194 (GRCm39) missense probably benign 0.00
IGL01074:Ush1c APN 7 45,874,674 (GRCm39) splice site probably benign
IGL01099:Ush1c APN 7 45,854,686 (GRCm39) missense probably damaging 0.99
IGL01107:Ush1c APN 7 45,859,325 (GRCm39) missense probably damaging 1.00
IGL01446:Ush1c APN 7 45,858,380 (GRCm39) missense possibly damaging 0.86
IGL02267:Ush1c APN 7 45,858,722 (GRCm39) missense possibly damaging 0.92
IGL02307:Ush1c APN 7 45,846,612 (GRCm39) splice site probably benign
IGL02448:Ush1c APN 7 45,858,561 (GRCm39) missense possibly damaging 0.51
IGL02485:Ush1c APN 7 45,878,674 (GRCm39) missense probably damaging 0.99
IGL02896:Ush1c APN 7 45,847,839 (GRCm39) missense probably benign 0.00
IGL03031:Ush1c APN 7 45,874,361 (GRCm39) splice site probably benign
R0085:Ush1c UTSW 7 45,874,979 (GRCm39) missense probably benign 0.09
R0328:Ush1c UTSW 7 45,874,872 (GRCm39) splice site probably benign
R0574:Ush1c UTSW 7 45,846,228 (GRCm39) missense possibly damaging 0.68
R0600:Ush1c UTSW 7 45,874,332 (GRCm39) missense probably benign 0.00
R1187:Ush1c UTSW 7 45,858,338 (GRCm39) missense probably benign 0.01
R1406:Ush1c UTSW 7 45,874,965 (GRCm39) critical splice donor site probably null
R1406:Ush1c UTSW 7 45,874,965 (GRCm39) critical splice donor site probably null
R1716:Ush1c UTSW 7 45,845,152 (GRCm39) missense probably benign 0.18
R1727:Ush1c UTSW 7 45,858,655 (GRCm39) missense probably damaging 1.00
R1822:Ush1c UTSW 7 45,859,325 (GRCm39) missense probably damaging 1.00
R1864:Ush1c UTSW 7 45,868,816 (GRCm39) nonsense probably null
R2000:Ush1c UTSW 7 45,870,857 (GRCm39) missense probably damaging 0.99
R2063:Ush1c UTSW 7 45,878,905 (GRCm39) missense probably damaging 1.00
R2068:Ush1c UTSW 7 45,878,905 (GRCm39) missense probably damaging 1.00
R2944:Ush1c UTSW 7 45,850,406 (GRCm39) missense probably damaging 1.00
R4042:Ush1c UTSW 7 45,870,952 (GRCm39) missense probably damaging 0.97
R4043:Ush1c UTSW 7 45,870,952 (GRCm39) missense probably damaging 0.97
R4108:Ush1c UTSW 7 45,847,869 (GRCm39) missense probably damaging 1.00
R4862:Ush1c UTSW 7 45,878,664 (GRCm39) missense probably damaging 1.00
R5534:Ush1c UTSW 7 45,870,847 (GRCm39) missense probably damaging 1.00
R5922:Ush1c UTSW 7 45,853,552 (GRCm39) critical splice donor site probably null
R6249:Ush1c UTSW 7 45,864,383 (GRCm39) missense probably damaging 1.00
R6475:Ush1c UTSW 7 45,878,643 (GRCm39) missense probably damaging 0.99
R6485:Ush1c UTSW 7 45,858,534 (GRCm39) missense probably benign
R6667:Ush1c UTSW 7 45,875,048 (GRCm39) missense probably damaging 1.00
R7177:Ush1c UTSW 7 45,878,643 (GRCm39) missense probably damaging 0.99
R7419:Ush1c UTSW 7 45,878,679 (GRCm39) missense probably damaging 1.00
R7424:Ush1c UTSW 7 45,874,979 (GRCm39) missense probably benign 0.09
R7811:Ush1c UTSW 7 45,854,710 (GRCm39) nonsense probably null
R7862:Ush1c UTSW 7 45,870,848 (GRCm39) missense probably damaging 0.99
R8182:Ush1c UTSW 7 45,847,775 (GRCm39) critical splice donor site probably null
R8340:Ush1c UTSW 7 45,860,630 (GRCm39) missense probably benign 0.41
R8470:Ush1c UTSW 7 45,858,674 (GRCm39) missense probably damaging 1.00
R8478:Ush1c UTSW 7 45,870,857 (GRCm39) missense probably damaging 0.99
R9025:Ush1c UTSW 7 45,846,614 (GRCm39) splice site probably benign
R9076:Ush1c UTSW 7 45,850,480 (GRCm39) missense probably damaging 1.00
R9129:Ush1c UTSW 7 45,854,629 (GRCm39) missense probably benign 0.23
R9398:Ush1c UTSW 7 45,869,934 (GRCm39) missense probably benign 0.08
R9418:Ush1c UTSW 7 45,872,292 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCAGTTGATCCTTGCTCCAC -3'
(R):5'- GACAAGTGACTCCTGTCCTTCC -3'

Sequencing Primer
(F):5'- ACCTCTTGCTGGCCTTCAGAG -3'
(R):5'- AATCCTGACACCCTTTTGACC -3'
Posted On 2016-08-16