Mutagenetix > Incidental Mutation

Incidental Mutation 'R4823:Cebpd'

426182

Institutional Source

Beutler Lab

Gene Symbol

Cebpd

Ensembl Gene

ENSMUSG00000071637

Gene Name

CCAAT/enhancer binding protein (C/EBP), delta

Synonyms

MMRRC Submission

042439-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4823 (G1)

Quality Score

156

Status

Validated

Chromosome

Chromosomal Location

15887286-15891031 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 15888114 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 264 (G264S)

Ref Sequence

ENSEMBL: ENSMUSP00000148145 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040248] [ENSMUST00000096232]

AlphaFold

Q00322

Predicted Effect

probably benign
Transcript: ENSMUST00000040248

SMART Domains

Protein: ENSMUSP00000038820
Gene: ENSMUSG00000041974

Domain	Start	End	E-Value	Type
Pfam:DUF4502	11	390	1.8e-177	PFAM
low complexity region	499	508	N/A	INTRINSIC
Pfam:DUF4503	540	921	2.2e-179	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000096232
AA Change: G264S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210772

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

98% (96/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this intronless gene is a bZIP transcription factor which can bind as a homodimer to certain DNA regulatory regions. It can also form heterodimers with the related protein CEBP-alpha. The encoded protein is important in the regulation of genes involved in immune and inflammatory responses, and may be involved in the regulation of genes associated with activation and/or differentiation of macrophages. The cytogenetic location of this locus has been reported as both 8p11 and 8q11. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and healthy and perform normally on several behavioral tasks, but display enhanced contextual fear conditioning. Mice homozygous for a second knock-out allele exhibit nearly normal or only slightly impaired adipocyte differentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	G	A	5: 87,972,598	D405N	probably benign	Het
4921517D22Rik	T	G	13: 59,690,904	E38A	probably damaging	Het
4930433I11Rik	A	T	7: 40,993,362	I152F	probably benign	Het
5830473C10Rik	T	A	5: 90,566,503	L124H	probably benign	Het
Aass	A	T	6: 23,107,691	D364E	probably benign	Het
Adamts2	A	G	11: 50,737,187	D238G	probably benign	Het
Aplf	G	A	6: 87,646,255	L302F	probably damaging	Het
Apol7b	G	T	15: 77,427,782		probably benign	Het
Arhgef12	A	G	9: 43,020,696	V165A	probably benign	Het
Ascc3	T	C	10: 50,713,233	S1017P	probably damaging	Het
B230104I21Rik	T	A	4: 154,349,747		probably benign	Het
Bfsp2	C	A	9: 103,479,883	C115F	probably damaging	Het
Bhmt2	A	T	13: 93,663,290	W213R	probably benign	Het
C87499	T	C	4: 88,629,215	K160R	probably damaging	Het
Capn5	A	T	7: 98,126,441	V431E	probably damaging	Het
Ccdc88c	A	G	12: 100,930,543	Y1390H	probably damaging	Het
Ccr3	A	G	9: 124,028,681	T18A	probably damaging	Het
Cdh5	T	C	8: 104,142,669	S676P	probably benign	Het
Ceacam5	A	G	7: 17,757,744	T680A	possibly damaging	Het
Cfd	T	C	10: 79,890,948	V8A	probably benign	Het
Cops9	C	T	1: 92,641,866		probably benign	Het
Cpne6	T	C	14: 55,517,010	Y533H	probably damaging	Het
Cyp2c67	T	A	19: 39,615,724	H396L	probably benign	Het
Cyp2j9	G	A	4: 96,568,735	P500S	possibly damaging	Het
Cyp4a12a	A	T	4: 115,327,413		probably null	Het
Dbt	G	A	3: 116,523,387	D71N	probably damaging	Het
Ddx41	G	T	13: 55,532,055	Q440K	probably benign	Het
Doxl2	A	G	6: 48,975,261	D40G	probably damaging	Het
Elovl4	A	G	9: 83,780,685	F174S	probably damaging	Het
Emcn	C	G	3: 137,423,426	P193R	probably damaging	Het
Etnk1	T	C	6: 143,167,638		probably null	Het
Fads3	A	C	19: 10,041,888	S53R	probably damaging	Het
Fam193a	A	G	5: 34,459,028	E849G	probably damaging	Het
Fat3	A	G	9: 15,996,507	V2733A	probably benign	Het
Frem3	T	A	8: 80,613,958	M960K	probably benign	Het
Frmd6	A	T	12: 70,872,575	I62L	probably benign	Het
Glmp	T	C	3: 88,325,223		probably benign	Het
Gm17421	T	C	12: 113,369,541		noncoding transcript	Het
Gm27013	T	A	6: 130,522,223		noncoding transcript	Het
Gtf2ird1	A	G	5: 134,395,722	V390A	probably damaging	Het
Hps3	A	G	3: 20,012,726	Y559H	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Itpr3	A	G	17: 27,085,147	D114G	probably benign	Het
Jmjd4	G	A	11: 59,455,580	A408T	probably benign	Het
Kcnh4	G	T	11: 100,755,174	A316D	probably damaging	Het
Klrg1	T	A	6: 122,273,533		probably null	Het
Lancl2	T	A	6: 57,732,277	Y355N	probably damaging	Het
Ltb	T	C	17: 35,195,230	S115P	probably benign	Het
Mccc2	T	G	13: 100,000,254	R64S	probably benign	Het
Mgam2-ps	T	A	6: 40,832,662		noncoding transcript	Het
Mrrf	T	G	2: 36,148,030	N104K	possibly damaging	Het
Nipa1	C	A	7: 55,979,688	V226L	possibly damaging	Het
Numa1	T	A	7: 101,996,037	L290Q	probably damaging	Het
Ofcc1	T	A	13: 40,280,473	H52L	probably damaging	Het
Ogfod3	G	A	11: 121,195,201	A189V	probably benign	Het
Olfr1176	A	G	2: 88,339,835	D90G	probably damaging	Het
Olfr1444	A	T	19: 12,861,816	I14F	probably benign	Het
Olfr1505	G	A	19: 13,919,658	V213I	probably benign	Het
Olfr292	T	A	7: 86,694,588	I44N	probably damaging	Het
P2ry12	G	A	3: 59,217,897	S119L	probably benign	Het
Pde7b	T	A	10: 20,438,785	N192Y	probably damaging	Het
Pfkl	T	C	10: 77,997,594	N258S	probably damaging	Het
Phykpl	G	A	11: 51,586,593	A71T	probably damaging	Het
Ppp1r16a	T	C	15: 76,693,193		probably benign	Het
Pramef20	T	C	4: 144,373,211	N328S	possibly damaging	Het
Prune2	C	T	19: 17,120,504	T1124M	probably damaging	Het
Rapgef6	A	G	11: 54,694,500	I1570V	probably benign	Het
Rbm34	T	C	8: 126,970,905	S19G	probably benign	Het
Rnf10	T	C	5: 115,255,442		probably null	Het
Rnf34	A	G	5: 122,850,302		probably null	Het
Setd4	A	G	16: 93,589,950	S287P	probably benign	Het
Shc3	C	T	13: 51,451,570	V225I	probably benign	Het
Sipa1l3	C	T	7: 29,371,002	V1030I	probably damaging	Het
Siva1	G	T	12: 112,645,064	R33L	probably damaging	Het
Slc4a5	C	T	6: 83,272,133	T573I	probably damaging	Het
Sorcs1	C	T	19: 50,678,140	R110Q	possibly damaging	Het
Sorcs1	T	C	19: 50,230,302	I581V	possibly damaging	Het
Sorl1	T	C	9: 41,992,321	D1545G	probably damaging	Het
Tas2r124	T	G	6: 132,755,546	S273A	probably damaging	Het
Tcf15	T	C	2: 152,143,893	F90L	probably damaging	Het
Trim59	G	A	3: 69,037,120	R296C	probably benign	Het
Tulp1	A	T	17: 28,353,572	D229E	probably benign	Het
Ush1c	T	A	7: 46,195,733	N886I	probably benign	Het
Usp9y	A	T	Y: 1,444,559	S127T	probably damaging	Het
Vmn1r19	T	A	6: 57,405,234	Y257*	probably null	Het
Vmn2r109	A	T	17: 20,553,891	Y401N	probably damaging	Het
Vmn2r69	A	C	7: 85,411,300	S359A	probably benign	Het
Zfp37	A	T	4: 62,191,503	N479K	probably benign	Het

Other mutations in Cebpd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R3958:Cebpd	UTSW	16	15887463	missense	possibly damaging	0.60
R4674:Cebpd	UTSW	16	15887521	missense	probably damaging	1.00
R4675:Cebpd	UTSW	16	15887521	missense	probably damaging	1.00
R4824:Cebpd	UTSW	16	15888114	missense	probably benign	0.01
R8163:Cebpd	UTSW	16	15887977	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGCCACGACGAACTCTTC -3'
(R):5'- GATTAATATAGCTTCTCTCGCAGTC -3'

Sequencing Primer
(F):5'- GCGCAACAACATCGCTGTG -3'
(R):5'- ATATAGCTTCTCTCGCAGTCCAGTG -3'

Posted On

2016-08-16