Incidental Mutation 'R4823:Sorcs1'
ID 426183
Institutional Source Beutler Lab
Gene Symbol Sorcs1
Ensembl Gene ENSMUSG00000043531
Gene Name sortilin-related VPS10 domain containing receptor 1
Synonyms
MMRRC Submission 042439-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.122) question?
Stock # R4823 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 50143299-50678646 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 50230302 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 581 (I581V)
Ref Sequence ENSEMBL: ENSMUSP00000147591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211008] [ENSMUST00000211687]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000072685
AA Change: I581V

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531
AA Change: I581V

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111756
AA Change: I581V

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531
AA Change: I581V

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164039
AA Change: I581V

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531
AA Change: I581V

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
low complexity region 1129 1142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168357
SMART Domains Protein: ENSMUSP00000129190
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
VPS10 1 320 6.99e-58 SMART
PKD 322 412 3.84e-1 SMART
PKD 420 498 8.63e-1 SMART
transmembrane domain 621 643 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209413
AA Change: I581V

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000209783
AA Change: I581V

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211008
AA Change: I581V

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211687
AA Change: I581V

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.1427 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 98% (96/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G A 5: 87,972,598 (GRCm38) D405N probably benign Het
4921517D22Rik T G 13: 59,690,904 (GRCm38) E38A probably damaging Het
4930433I11Rik A T 7: 40,993,362 (GRCm38) I152F probably benign Het
5830473C10Rik T A 5: 90,566,503 (GRCm38) L124H probably benign Het
Aass A T 6: 23,107,691 (GRCm38) D364E probably benign Het
Adamts2 A G 11: 50,737,187 (GRCm38) D238G probably benign Het
Aplf G A 6: 87,646,255 (GRCm38) L302F probably damaging Het
Apol7b G T 15: 77,427,782 (GRCm38) probably benign Het
Arhgef12 A G 9: 43,020,696 (GRCm38) V165A probably benign Het
Ascc3 T C 10: 50,713,233 (GRCm38) S1017P probably damaging Het
B230104I21Rik T A 4: 154,349,747 (GRCm38) probably benign Het
Bfsp2 C A 9: 103,479,883 (GRCm38) C115F probably damaging Het
Bhmt2 A T 13: 93,663,290 (GRCm38) W213R probably benign Het
C87499 T C 4: 88,629,215 (GRCm38) K160R probably damaging Het
Capn5 A T 7: 98,126,441 (GRCm38) V431E probably damaging Het
Ccdc88c A G 12: 100,930,543 (GRCm38) Y1390H probably damaging Het
Ccr3 A G 9: 124,028,681 (GRCm38) T18A probably damaging Het
Cdh5 T C 8: 104,142,669 (GRCm38) S676P probably benign Het
Ceacam5 A G 7: 17,757,744 (GRCm38) T680A possibly damaging Het
Cebpd G A 16: 15,888,114 (GRCm38) G264S probably benign Het
Cfd T C 10: 79,890,948 (GRCm38) V8A probably benign Het
Cops9 C T 1: 92,641,866 (GRCm38) probably benign Het
Cpne6 T C 14: 55,517,010 (GRCm38) Y533H probably damaging Het
Cyp2c67 T A 19: 39,615,724 (GRCm38) H396L probably benign Het
Cyp2j9 G A 4: 96,568,735 (GRCm38) P500S possibly damaging Het
Cyp4a12a A T 4: 115,327,413 (GRCm38) probably null Het
Dbt G A 3: 116,523,387 (GRCm38) D71N probably damaging Het
Ddx41 G T 13: 55,532,055 (GRCm38) Q440K probably benign Het
Doxl2 A G 6: 48,975,261 (GRCm38) D40G probably damaging Het
Elovl4 A G 9: 83,780,685 (GRCm38) F174S probably damaging Het
Emcn C G 3: 137,423,426 (GRCm38) P193R probably damaging Het
Etnk1 T C 6: 143,167,638 (GRCm38) probably null Het
Fads3 A C 19: 10,041,888 (GRCm38) S53R probably damaging Het
Fam193a A G 5: 34,459,028 (GRCm38) E849G probably damaging Het
Fat3 A G 9: 15,996,507 (GRCm38) V2733A probably benign Het
Frem3 T A 8: 80,613,958 (GRCm38) M960K probably benign Het
Frmd6 A T 12: 70,872,575 (GRCm38) I62L probably benign Het
Glmp T C 3: 88,325,223 (GRCm38) probably benign Het
Gm17421 T C 12: 113,369,541 (GRCm38) noncoding transcript Het
Gm27013 T A 6: 130,522,223 (GRCm38) noncoding transcript Het
Gtf2ird1 A G 5: 134,395,722 (GRCm38) V390A probably damaging Het
Hps3 A G 3: 20,012,726 (GRCm38) Y559H probably benign Het
Hsh2d G A 8: 72,200,460 (GRCm38) D229N probably benign Het
Itpr3 A G 17: 27,085,147 (GRCm38) D114G probably benign Het
Jmjd4 G A 11: 59,455,580 (GRCm38) A408T probably benign Het
Kcnh4 G T 11: 100,755,174 (GRCm38) A316D probably damaging Het
Klrg1 T A 6: 122,273,533 (GRCm38) probably null Het
Lancl2 T A 6: 57,732,277 (GRCm38) Y355N probably damaging Het
Ltb T C 17: 35,195,230 (GRCm38) S115P probably benign Het
Mccc2 T G 13: 100,000,254 (GRCm38) R64S probably benign Het
Mgam2-ps T A 6: 40,832,662 (GRCm38) noncoding transcript Het
Mrrf T G 2: 36,148,030 (GRCm38) N104K possibly damaging Het
Nipa1 C A 7: 55,979,688 (GRCm38) V226L possibly damaging Het
Numa1 T A 7: 101,996,037 (GRCm38) L290Q probably damaging Het
Ofcc1 T A 13: 40,280,473 (GRCm38) H52L probably damaging Het
Ogfod3 G A 11: 121,195,201 (GRCm38) A189V probably benign Het
Olfr1176 A G 2: 88,339,835 (GRCm38) D90G probably damaging Het
Olfr1444 A T 19: 12,861,816 (GRCm38) I14F probably benign Het
Olfr1505 G A 19: 13,919,658 (GRCm38) V213I probably benign Het
Olfr292 T A 7: 86,694,588 (GRCm38) I44N probably damaging Het
P2ry12 G A 3: 59,217,897 (GRCm38) S119L probably benign Het
Pde7b T A 10: 20,438,785 (GRCm38) N192Y probably damaging Het
Pfkl T C 10: 77,997,594 (GRCm38) N258S probably damaging Het
Phykpl G A 11: 51,586,593 (GRCm38) A71T probably damaging Het
Ppp1r16a T C 15: 76,693,193 (GRCm38) probably benign Het
Pramef20 T C 4: 144,373,211 (GRCm38) N328S possibly damaging Het
Prune2 C T 19: 17,120,504 (GRCm38) T1124M probably damaging Het
Rapgef6 A G 11: 54,694,500 (GRCm38) I1570V probably benign Het
Rbm34 T C 8: 126,970,905 (GRCm38) S19G probably benign Het
Rnf10 T C 5: 115,255,442 (GRCm38) probably null Het
Rnf34 A G 5: 122,850,302 (GRCm38) probably null Het
Setd4 A G 16: 93,589,950 (GRCm38) S287P probably benign Het
Shc3 C T 13: 51,451,570 (GRCm38) V225I probably benign Het
Sipa1l3 C T 7: 29,371,002 (GRCm38) V1030I probably damaging Het
Siva1 G T 12: 112,645,064 (GRCm38) R33L probably damaging Het
Slc4a5 C T 6: 83,272,133 (GRCm38) T573I probably damaging Het
Sorl1 T C 9: 41,992,321 (GRCm38) D1545G probably damaging Het
Tas2r124 T G 6: 132,755,546 (GRCm38) S273A probably damaging Het
Tcf15 T C 2: 152,143,893 (GRCm38) F90L probably damaging Het
Trim59 G A 3: 69,037,120 (GRCm38) R296C probably benign Het
Tulp1 A T 17: 28,353,572 (GRCm38) D229E probably benign Het
Ush1c T A 7: 46,195,733 (GRCm38) N886I probably benign Het
Usp9y A T Y: 1,444,559 (GRCm38) S127T probably damaging Het
Vmn1r19 T A 6: 57,405,234 (GRCm38) Y257* probably null Het
Vmn2r109 A T 17: 20,553,891 (GRCm38) Y401N probably damaging Het
Vmn2r69 A C 7: 85,411,300 (GRCm38) S359A probably benign Het
Zfp37 A T 4: 62,191,503 (GRCm38) N479K probably benign Het
Other mutations in Sorcs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Sorcs1 APN 19 50,190,054 (GRCm38) missense probably damaging 1.00
IGL00983:Sorcs1 APN 19 50,176,128 (GRCm38) missense probably damaging 0.98
IGL01125:Sorcs1 APN 19 50,228,201 (GRCm38) missense probably damaging 1.00
IGL01320:Sorcs1 APN 19 50,288,079 (GRCm38) splice site probably benign
IGL01445:Sorcs1 APN 19 50,153,066 (GRCm38) missense probably damaging 1.00
IGL01682:Sorcs1 APN 19 50,181,506 (GRCm38) missense probably benign 0.43
IGL01799:Sorcs1 APN 19 50,230,209 (GRCm38) critical splice donor site probably null
IGL02044:Sorcs1 APN 19 50,288,159 (GRCm38) splice site probably benign
IGL02111:Sorcs1 APN 19 50,230,245 (GRCm38) missense probably benign 0.00
IGL02364:Sorcs1 APN 19 50,333,598 (GRCm38) missense probably damaging 1.00
IGL02378:Sorcs1 APN 19 50,182,671 (GRCm38) nonsense probably null
IGL02498:Sorcs1 APN 19 50,678,168 (GRCm38) missense probably benign
IGL02658:Sorcs1 APN 19 50,190,092 (GRCm38) missense probably damaging 1.00
IGL02939:Sorcs1 APN 19 50,677,930 (GRCm38) nonsense probably null
IGL02942:Sorcs1 APN 19 50,475,437 (GRCm38) missense probably damaging 1.00
IGL03057:Sorcs1 APN 19 50,259,756 (GRCm38) nonsense probably null
IGL03230:Sorcs1 APN 19 50,242,093 (GRCm38) missense probably damaging 1.00
P0033:Sorcs1 UTSW 19 50,152,907 (GRCm38) missense probably damaging 0.98
R0109:Sorcs1 UTSW 19 50,378,891 (GRCm38) splice site probably benign
R0115:Sorcs1 UTSW 19 50,636,453 (GRCm38) intron probably benign
R0242:Sorcs1 UTSW 19 50,228,221 (GRCm38) missense probably damaging 1.00
R0242:Sorcs1 UTSW 19 50,228,221 (GRCm38) missense probably damaging 1.00
R0325:Sorcs1 UTSW 19 50,313,042 (GRCm38) splice site probably null
R0481:Sorcs1 UTSW 19 50,636,453 (GRCm38) intron probably benign
R0581:Sorcs1 UTSW 19 50,252,701 (GRCm38) missense possibly damaging 0.70
R0669:Sorcs1 UTSW 19 50,241,942 (GRCm38) splice site probably benign
R0980:Sorcs1 UTSW 19 50,232,323 (GRCm38) missense probably benign 0.04
R1158:Sorcs1 UTSW 19 50,144,160 (GRCm38) unclassified probably benign
R1519:Sorcs1 UTSW 19 50,252,587 (GRCm38) missense probably benign 0.05
R1669:Sorcs1 UTSW 19 50,475,422 (GRCm38) missense probably damaging 0.99
R1779:Sorcs1 UTSW 19 50,175,043 (GRCm38) splice site probably benign
R1783:Sorcs1 UTSW 19 50,228,309 (GRCm38) critical splice acceptor site probably null
R1927:Sorcs1 UTSW 19 50,222,195 (GRCm38) missense probably damaging 1.00
R1935:Sorcs1 UTSW 19 50,232,644 (GRCm38) missense probably damaging 0.96
R1936:Sorcs1 UTSW 19 50,232,644 (GRCm38) missense probably damaging 0.96
R2109:Sorcs1 UTSW 19 50,678,192 (GRCm38) missense probably benign
R2206:Sorcs1 UTSW 19 50,230,217 (GRCm38) missense possibly damaging 0.81
R2207:Sorcs1 UTSW 19 50,230,217 (GRCm38) missense possibly damaging 0.81
R3031:Sorcs1 UTSW 19 50,225,175 (GRCm38) missense probably damaging 0.98
R3032:Sorcs1 UTSW 19 50,225,175 (GRCm38) missense probably damaging 0.98
R3107:Sorcs1 UTSW 19 50,210,650 (GRCm38) missense possibly damaging 0.83
R3508:Sorcs1 UTSW 19 50,225,175 (GRCm38) missense probably damaging 0.98
R3738:Sorcs1 UTSW 19 50,151,221 (GRCm38) missense probably benign 0.03
R4127:Sorcs1 UTSW 19 50,222,159 (GRCm38) missense probably benign 0.29
R4212:Sorcs1 UTSW 19 50,225,175 (GRCm38) missense probably damaging 0.98
R4213:Sorcs1 UTSW 19 50,225,175 (GRCm38) missense probably damaging 0.98
R4385:Sorcs1 UTSW 19 50,190,161 (GRCm38) missense probably benign 0.01
R4424:Sorcs1 UTSW 19 50,378,941 (GRCm38) missense probably damaging 0.97
R4603:Sorcs1 UTSW 19 50,312,964 (GRCm38) critical splice donor site probably null
R4679:Sorcs1 UTSW 19 50,182,669 (GRCm38) missense probably benign
R4780:Sorcs1 UTSW 19 50,143,981 (GRCm38) unclassified probably benign
R4781:Sorcs1 UTSW 19 50,182,681 (GRCm38) missense probably damaging 1.00
R4823:Sorcs1 UTSW 19 50,678,140 (GRCm38) missense possibly damaging 0.92
R4883:Sorcs1 UTSW 19 50,232,303 (GRCm38) missense probably benign 0.00
R5091:Sorcs1 UTSW 19 50,259,752 (GRCm38) critical splice donor site probably null
R5105:Sorcs1 UTSW 19 50,225,141 (GRCm38) missense possibly damaging 0.57
R5437:Sorcs1 UTSW 19 50,252,602 (GRCm38) missense probably benign 0.19
R5574:Sorcs1 UTSW 19 50,222,133 (GRCm38) missense probably damaging 1.00
R5734:Sorcs1 UTSW 19 50,182,775 (GRCm38) missense probably benign 0.04
R6045:Sorcs1 UTSW 19 50,190,117 (GRCm38) nonsense probably null
R6091:Sorcs1 UTSW 19 50,288,101 (GRCm38) missense possibly damaging 0.64
R6119:Sorcs1 UTSW 19 50,288,094 (GRCm38) missense probably damaging 0.98
R6226:Sorcs1 UTSW 19 50,181,414 (GRCm38) missense probably damaging 1.00
R6337:Sorcs1 UTSW 19 50,144,124 (GRCm38) missense probably benign 0.00
R6378:Sorcs1 UTSW 19 50,225,177 (GRCm38) missense possibly damaging 0.57
R6782:Sorcs1 UTSW 19 50,176,122 (GRCm38) nonsense probably null
R6792:Sorcs1 UTSW 19 50,678,168 (GRCm38) missense probably benign
R6891:Sorcs1 UTSW 19 50,225,119 (GRCm38) nonsense probably null
R7151:Sorcs1 UTSW 19 50,312,982 (GRCm38) missense probably damaging 1.00
R7223:Sorcs1 UTSW 19 50,190,042 (GRCm38) missense probably benign 0.06
R7356:Sorcs1 UTSW 19 50,175,157 (GRCm38) missense possibly damaging 0.86
R7471:Sorcs1 UTSW 19 50,262,263 (GRCm38) missense probably damaging 1.00
R7474:Sorcs1 UTSW 19 50,153,112 (GRCm38) missense possibly damaging 0.65
R7503:Sorcs1 UTSW 19 50,153,052 (GRCm38) missense probably benign
R7506:Sorcs1 UTSW 19 50,182,674 (GRCm38) nonsense probably null
R7573:Sorcs1 UTSW 19 50,152,796 (GRCm38) nonsense probably null
R7867:Sorcs1 UTSW 19 50,230,260 (GRCm38) nonsense probably null
R7911:Sorcs1 UTSW 19 50,144,032 (GRCm38) missense unknown
R8032:Sorcs1 UTSW 19 50,475,408 (GRCm38) missense probably benign 0.28
R8063:Sorcs1 UTSW 19 50,143,977 (GRCm38) missense unknown
R8463:Sorcs1 UTSW 19 50,259,810 (GRCm38) missense probably damaging 1.00
R8682:Sorcs1 UTSW 19 50,378,960 (GRCm38) missense probably damaging 0.99
R8724:Sorcs1 UTSW 19 50,151,220 (GRCm38) missense probably benign 0.33
R8926:Sorcs1 UTSW 19 50,252,658 (GRCm38) missense possibly damaging 0.94
R9160:Sorcs1 UTSW 19 50,225,220 (GRCm38) missense probably damaging 1.00
R9173:Sorcs1 UTSW 19 50,232,315 (GRCm38) missense possibly damaging 0.92
R9203:Sorcs1 UTSW 19 50,262,295 (GRCm38) missense probably damaging 1.00
R9229:Sorcs1 UTSW 19 50,152,862 (GRCm38) missense probably benign 0.17
R9398:Sorcs1 UTSW 19 50,225,213 (GRCm38) missense possibly damaging 0.90
R9430:Sorcs1 UTSW 19 50,210,770 (GRCm38) missense probably damaging 1.00
R9510:Sorcs1 UTSW 19 50,678,083 (GRCm38) missense probably benign 0.04
R9511:Sorcs1 UTSW 19 50,678,083 (GRCm38) missense probably benign 0.04
R9744:Sorcs1 UTSW 19 50,226,837 (GRCm38) missense probably damaging 1.00
R9777:Sorcs1 UTSW 19 50,259,752 (GRCm38) critical splice donor site probably null
X0024:Sorcs1 UTSW 19 50,182,763 (GRCm38) missense possibly damaging 0.92
Z1088:Sorcs1 UTSW 19 50,222,143 (GRCm38) missense probably benign 0.16
Z1177:Sorcs1 UTSW 19 50,333,599 (GRCm38) missense probably damaging 1.00
Z1177:Sorcs1 UTSW 19 50,226,742 (GRCm38) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TCCCCTTTTCAAAAGCAGGTC -3'
(R):5'- TCACTGCATTTCTGAGGTAGATG -3'

Sequencing Primer
(F):5'- AAGCAGGTCACAGTCTTATCTC -3'
(R):5'- GTAGCCCATGTTGAAAAGCATTG -3'
Posted On 2016-08-16