Incidental Mutation 'R4821:Abcb9'
ID426189
Institutional Source Beutler Lab
Gene Symbol Abcb9
Ensembl Gene ENSMUSG00000029408
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 9
SynonymsTAPL
MMRRC Submission 042437-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4821 (G1)
Quality Score58
Status Validated
Chromosome5
Chromosomal Location124061530-124095798 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124090149 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 10 (T10A)
Ref Sequence ENSEMBL: ENSMUSP00000122969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031354] [ENSMUST00000126856] [ENSMUST00000141510]
Predicted Effect probably benign
Transcript: ENSMUST00000031354
AA Change: T10A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000031354
Gene: ENSMUSG00000029408
AA Change: T10A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 82 104 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 184 453 1.9e-61 PFAM
AAA 527 713 4.07e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126856
AA Change: T10A

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000118908
Gene: ENSMUSG00000029408
AA Change: T10A

DomainStartEndE-ValueType
transmembrane domain 7 27 N/A INTRINSIC
transmembrane domain 47 69 N/A INTRINSIC
transmembrane domain 82 104 N/A INTRINSIC
transmembrane domain 114 136 N/A INTRINSIC
transmembrane domain 181 203 N/A INTRINSIC
transmembrane domain 218 237 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126970
Predicted Effect probably benign
Transcript: ENSMUST00000141510
AA Change: T10A

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000122969
Gene: ENSMUSG00000029408
AA Change: T10A

DomainStartEndE-ValueType
transmembrane domain 7 27 N/A INTRINSIC
transmembrane domain 47 69 N/A INTRINSIC
transmembrane domain 82 104 N/A INTRINSIC
transmembrane domain 114 136 N/A INTRINSIC
transmembrane domain 181 203 N/A INTRINSIC
transmembrane domain 218 237 N/A INTRINSIC
Meta Mutation Damage Score 0.1034 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. The function of this half-transporter has not yet been determined; however, it may be associated with lysosome activity. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,235,674 K150R probably damaging Het
4930430A15Rik T C 2: 111,204,145 probably null Het
Aak1 T C 6: 86,850,189 V46A probably damaging Het
Acaca A G 11: 84,294,987 D116G possibly damaging Het
Adam33 G A 2: 131,061,195 P43L probably benign Het
Adamtsl2 T A 2: 27,098,592 probably null Het
Akap13 A G 7: 75,677,507 probably benign Het
Art1 T A 7: 102,107,178 L192Q probably damaging Het
Baalc A G 15: 38,933,180 probably benign Het
Baz2a A G 10: 128,111,109 E164G probably damaging Het
Bcs1l A G 1: 74,591,985 I391V probably benign Het
Cacna1c T C 6: 118,696,425 T497A probably damaging Het
Cap2 C A 13: 46,610,110 T164N probably damaging Het
Ccdc173 T C 2: 69,782,108 E96G possibly damaging Het
Ccdc57 A G 11: 120,860,399 probably null Het
Ccdc88c T C 12: 100,938,079 N1120S probably benign Het
Chd7 T A 4: 8,844,706 V1605D probably damaging Het
Col12a1 A T 9: 79,715,340 probably benign Het
Commd3 T C 2: 18,672,528 S22P probably benign Het
Cpd T C 11: 76,846,237 I244V probably benign Het
Cpeb2 C A 5: 43,233,474 probably benign Het
Cyp2c65 A G 19: 39,072,191 D165G probably damaging Het
Ddx1 T C 12: 13,239,147 Y152C probably damaging Het
Dennd4a G A 9: 64,897,249 C1290Y possibly damaging Het
Ebf4 G A 2: 130,307,045 M232I probably benign Het
Farp2 A G 1: 93,574,470 probably null Het
Frk T C 10: 34,484,237 V78A probably benign Het
Gm5799 A G 14: 43,544,641 D90G probably damaging Het
Gpr45 C G 1: 43,030,453 probably benign Het
Hfm1 C T 5: 106,854,740 probably null Het
Igkv4-57-1 T A 6: 69,544,403 D105V probably damaging Het
Impdh2-ps A G 8: 100,031,363 noncoding transcript Het
Kctd4 G A 14: 75,962,777 V63I probably benign Het
Lcn6 T A 2: 25,680,810 L137M probably damaging Het
Lonrf1 T C 8: 36,219,972 N737D probably benign Het
Mcu C T 10: 59,467,689 V109M probably damaging Het
Mecom C A 3: 29,985,351 K186N probably damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Mybpc1 T C 10: 88,548,865 D533G probably damaging Het
Nae1 A C 8: 104,519,784 C294G probably damaging Het
Ncapg2 T G 12: 116,415,457 H190Q probably damaging Het
Nkx2-2 A T 2: 147,185,843 L59Q possibly damaging Het
Nrxn3 C T 12: 90,204,709 T295I probably damaging Het
Obscn A T 11: 59,040,467 M5781K probably damaging Het
Obscn C T 11: 59,006,826 probably benign Het
Olfr1285 T C 2: 111,409,225 noncoding transcript Het
Olfr1427 T A 19: 12,098,746 M298L probably benign Het
Olfr739 A G 14: 50,424,749 T77A possibly damaging Het
Pcdhb6 C A 18: 37,334,328 P101T probably damaging Het
Pot1b A G 17: 55,672,885 S324P possibly damaging Het
Ppcdc C T 9: 57,434,911 V43I probably benign Het
Prr13 A T 15: 102,460,685 probably benign Het
Rab10os T A 12: 3,237,322 noncoding transcript Het
Rabgap1 T C 2: 37,532,519 S595P probably damaging Het
Rap1gap T C 4: 137,712,129 S126P probably damaging Het
Rgs6 A T 12: 83,067,411 probably null Het
Slc5a6 T A 5: 31,036,884 K610* probably null Het
Sun5 C T 2: 153,869,466 V27I probably benign Het
Tmco5b T C 2: 113,289,757 I126T probably benign Het
Tmed7 G A 18: 46,593,413 Q92* probably null Het
Trav7d-2 A G 14: 52,684,428 D98G probably benign Het
Trbv16 T A 6: 41,152,002 L40Q probably damaging Het
Ush2a T C 1: 188,753,651 V2986A probably benign Het
Usp33 T C 3: 152,358,673 V58A probably benign Het
Vmn2r94 T A 17: 18,257,031 M373L probably benign Het
Ywhaq T C 12: 21,417,511 probably benign Het
Zbbx G A 3: 75,081,747 H345Y possibly damaging Het
Zfp346 G T 13: 55,113,813 probably benign Het
Zfp616 C T 11: 74,084,207 A434V probably benign Het
Zfp992 C T 4: 146,467,519 H566Y probably damaging Het
Other mutations in Abcb9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Abcb9 APN 5 124077238 missense possibly damaging 0.90
R0045:Abcb9 UTSW 5 124082085 missense probably damaging 0.96
R0106:Abcb9 UTSW 5 124083060 missense possibly damaging 0.70
R0153:Abcb9 UTSW 5 124080056 missense probably benign 0.00
R0194:Abcb9 UTSW 5 124077295 missense probably damaging 0.99
R0458:Abcb9 UTSW 5 124082146 critical splice acceptor site probably null
R0669:Abcb9 UTSW 5 124062887 missense probably damaging 0.97
R1240:Abcb9 UTSW 5 124089921 missense probably benign 0.02
R1480:Abcb9 UTSW 5 124078826 missense probably benign 0.00
R1544:Abcb9 UTSW 5 124083631 missense probably benign
R1878:Abcb9 UTSW 5 124090136 missense probably benign 0.02
R2355:Abcb9 UTSW 5 124077305 frame shift probably null
R2358:Abcb9 UTSW 5 124077305 frame shift probably null
R2520:Abcb9 UTSW 5 124080028 splice site probably null
R2926:Abcb9 UTSW 5 124078839 missense possibly damaging 0.84
R3795:Abcb9 UTSW 5 124090149 missense probably benign 0.05
R3911:Abcb9 UTSW 5 124089846 missense probably benign 0.06
R4679:Abcb9 UTSW 5 124078804 missense probably benign 0.20
R4789:Abcb9 UTSW 5 124078790 missense probably benign 0.00
R5116:Abcb9 UTSW 5 124078867 missense probably damaging 1.00
R5804:Abcb9 UTSW 5 124080055 missense probably benign
R5997:Abcb9 UTSW 5 124089815 missense possibly damaging 0.85
R6197:Abcb9 UTSW 5 124071749 nonsense probably null
R7172:Abcb9 UTSW 5 124062806 nonsense probably null
R7705:Abcb9 UTSW 5 124081955 nonsense probably null
R7783:Abcb9 UTSW 5 124078812 nonsense probably null
R8043:Abcb9 UTSW 5 124073602 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTTTGGCCATGGCATAGATG -3'
(R):5'- TCATGCAGCCATAGGAGTCC -3'

Sequencing Primer
(F):5'- TGATGACGAGCCACGAAGCC -3'
(R):5'- AGCCATAGGAGTCCCCTCG -3'
Posted On2016-08-17