Incidental Mutation 'R4774:Apopt1'
ID426200
Institutional Source Beutler Lab
Gene Symbol Apopt1
Ensembl Gene ENSMUSG00000037787
Gene Nameapoptogenic, mitochondrial 1
Synonyms1700081D05Rik, 2810002N01Rik, Apop-1
MMRRC Submission 042412-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.250) question?
Stock #R4774 (G1)
Quality Score80
Status Validated
Chromosome12
Chromosomal Location111713261-111755053 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111713389 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 33 (T33A)
Ref Sequence ENSEMBL: ENSMUSP00000124919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040519] [ENSMUST00000054636] [ENSMUST00000159557] [ENSMUST00000160576] [ENSMUST00000160825] [ENSMUST00000162316] [ENSMUST00000162953] [ENSMUST00000163220]
Predicted Effect probably benign
Transcript: ENSMUST00000040519
AA Change: T33A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038865
Gene: ENSMUSG00000037787
AA Change: T33A

DomainStartEndE-ValueType
Pfam:DUF2315 54 182 5.5e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054636
SMART Domains Protein: ENSMUSP00000051049
Gene: ENSMUSG00000049792

DomainStartEndE-ValueType
BAG 9 86 6.38e-21 SMART
Blast:BAG 101 165 2e-13 BLAST
BAG 182 260 6.94e-22 SMART
BAG 275 350 2.65e-18 SMART
BAG 365 442 9.88e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159557
AA Change: T33A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000160366
AA Change: T33A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000123929
Gene: ENSMUSG00000037787
AA Change: T33A

DomainStartEndE-ValueType
Pfam:DUF2315 53 162 3.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160576
SMART Domains Protein: ENSMUSP00000125183
Gene: ENSMUSG00000049792

DomainStartEndE-ValueType
BAG 9 86 6.38e-21 SMART
Blast:BAG 101 165 2e-13 BLAST
BAG 182 260 6.94e-22 SMART
BAG 275 350 2.65e-18 SMART
BAG 365 442 9.88e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160825
SMART Domains Protein: ENSMUSP00000123839
Gene: ENSMUSG00000049792

DomainStartEndE-ValueType
Pfam:BAG 12 60 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162316
AA Change: T33A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125711
Gene: ENSMUSG00000037787
AA Change: T33A

DomainStartEndE-ValueType
Pfam:DUF2315 53 130 7.5e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162953
Predicted Effect probably benign
Transcript: ENSMUST00000163220
AA Change: T33A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131169
Gene: ENSMUSG00000037787
AA Change: T33A

DomainStartEndE-ValueType
Pfam:DUF2315 54 162 3.7e-46 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that localizes to the mitochondria, where it stimulates the release of cytochrome c, thereby promoting programmed cell death. Mutations in this gene have been found in individuals with mitochondrial complex IV deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,639,317 I844V probably damaging Het
Acnat1 T A 4: 49,450,784 Y109F probably benign Het
Alox12b T C 11: 69,163,207 V205A probably benign Het
Arl6ip1 G A 7: 118,121,985 R77C probably damaging Het
Atp8b1 A G 18: 64,533,659 C1156R possibly damaging Het
Atp8b3 A C 10: 80,536,322 N24K probably damaging Het
Bdh1 T C 16: 31,455,136 V209A possibly damaging Het
Blm A T 7: 80,463,848 C1234S probably damaging Het
Caml A G 13: 55,631,927 D271G possibly damaging Het
Capn11 T C 17: 45,633,080 D545G probably benign Het
Catspere1 T C 1: 177,937,738 noncoding transcript Het
Ccdc114 T A 7: 45,948,380 S571R probably damaging Het
Cep128 T C 12: 91,234,195 E347G probably damaging Het
Cngb3 A G 4: 19,415,713 T408A possibly damaging Het
Cog1 G A 11: 113,657,427 R18Q possibly damaging Het
Cps1 T C 1: 67,220,512 F1338L probably damaging Het
Csmd1 T C 8: 16,009,369 H2122R probably benign Het
Ctu2 T G 8: 122,481,112 S26A probably benign Het
Dbf4 G A 5: 8,403,062 probably benign Het
Ddx23 A T 15: 98,647,235 D663E probably benign Het
Dpep2 T C 8: 105,990,756 T123A possibly damaging Het
Eed A G 7: 89,964,768 I274T probably damaging Het
Eif3b A G 5: 140,419,500 D47G probably benign Het
Epas1 T C 17: 86,805,758 V124A probably damaging Het
Fam129a A T 1: 151,715,694 D529V probably damaging Het
Fer1l6 T C 15: 58,577,949 L668P probably damaging Het
Fnip2 C A 3: 79,465,721 E1017* probably null Het
Gm43517 A T 12: 49,389,907 probably benign Het
Got1 A G 19: 43,502,906 probably null Het
H2-Eb2 T A 17: 34,334,401 V187E probably damaging Het
H2-Q1 T C 17: 35,321,266 probably benign Het
Hpgd T C 8: 56,298,419 V94A probably damaging Het
Htra1 T A 7: 130,985,026 N446K probably benign Het
Igkv3-4 T A 6: 70,672,285 S89R probably damaging Het
Immt C T 6: 71,852,736 T142I probably damaging Het
Itpkb C A 1: 180,418,194 P759T probably damaging Het
Jmjd1c G A 10: 67,224,792 V688I possibly damaging Het
Kbtbd13 G T 9: 65,390,743 R304S probably benign Het
Lama5 A C 2: 180,185,941 L2176R probably damaging Het
Lrp1b G C 2: 40,661,532 L418V probably null Het
Lrrc4b C A 7: 44,462,372 probably null Het
Lyst A G 13: 13,740,597 N3292S probably damaging Het
Mep1b A T 18: 21,086,184 I132F probably benign Het
Mettl2 A G 11: 105,126,610 probably null Het
Nmd3 T C 3: 69,745,236 L385S probably benign Het
Nol4 T C 18: 22,912,626 E243G probably damaging Het
Olfr1052 A T 2: 86,298,698 N294I possibly damaging Het
Olfr639 A G 7: 104,012,588 I38T probably benign Het
Olfr723 T A 14: 49,929,269 I92F probably damaging Het
Olfr917 A G 9: 38,665,223 I207T probably benign Het
Pcnp A G 16: 56,017,159 probably benign Het
Pla2g6 A C 15: 79,287,618 C680G probably damaging Het
Plekha7 G T 7: 116,144,943 D661E probably damaging Het
Prim1 A T 10: 128,027,018 probably benign Het
Psg29 T A 7: 17,210,535 N323K probably benign Het
Ptrh2 G A 11: 86,690,007 R150H probably damaging Het
Rasa1 A G 13: 85,250,502 probably benign Het
Rasa3 T C 8: 13,577,501 D667G probably benign Het
Rnase2a T C 14: 51,255,744 N55D probably damaging Het
Rsf1 GCGGCGGCGGCGGCGGCGGC GCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,916 probably benign Het
Sbp T A 17: 23,945,244 N133K probably damaging Het
Scml4 A G 10: 42,957,747 probably benign Het
Sema5b T A 16: 35,663,182 N1063K probably damaging Het
Serpind1 C T 16: 17,336,408 T33M probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc15a2 A T 16: 36,781,695 L80* probably null Het
Slc9a3r2 T C 17: 24,644,899 M1V probably null Het
Sorcs3 A G 19: 48,794,163 D1039G probably benign Het
Spon1 A G 7: 114,039,867 E776G probably damaging Het
Tdp1 C T 12: 99,902,364 A259V possibly damaging Het
Tex46 C A 4: 136,610,680 P61Q probably benign Het
Tnr T A 1: 159,897,066 L1109Q probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpra1 G A 6: 88,910,679 probably benign Het
Trim43c A T 9: 88,847,652 H383L possibly damaging Het
Trip6 A G 5: 137,310,171 C439R probably damaging Het
Tsen2 C T 6: 115,575,933 S398L possibly damaging Het
Tubgcp2 T C 7: 139,996,161 D863G probably damaging Het
Ube2d2a A G 18: 35,770,445 probably benign Het
Umad1 T A 6: 8,427,181 F145I probably damaging Het
Unc5c A T 3: 141,828,517 E933V probably damaging Het
Vmn1r208 A G 13: 22,772,476 F284L probably benign Het
Vmn2r53 T A 7: 12,600,765 R323* probably null Het
Zan G A 5: 137,389,019 T4924I unknown Het
Zfp597 G T 16: 3,865,987 Q302K probably benign Het
Other mutations in Apopt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02383:Apopt1 APN 12 111724413 splice site probably benign
R0336:Apopt1 UTSW 12 111733658 intron probably benign
R2324:Apopt1 UTSW 12 111724350 missense possibly damaging 0.87
R4436:Apopt1 UTSW 12 111751208 missense probably benign 0.03
R5161:Apopt1 UTSW 12 111722774 missense possibly damaging 0.55
R5376:Apopt1 UTSW 12 111730058 missense probably damaging 0.96
R5864:Apopt1 UTSW 12 111751218 missense probably benign 0.03
R6802:Apopt1 UTSW 12 111751191 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAAAACTTGTCCTCTCCTCG -3'
(R):5'- ACACCCTTCAAGAGCTGTG -3'

Sequencing Primer
(F):5'- AGGGAATGCGCACGGTC -3'
(R):5'- CACCCTTCAAGAGCTGTGTTAATAC -3'
Posted On2016-08-18