Incidental Mutation 'R4745:Bpifb1'
ID 426207
Institutional Source Beutler Lab
Gene Symbol Bpifb1
Ensembl Gene ENSMUSG00000027485
Gene Name BPI fold containing family B, member 1
Synonyms LPlunc1, von Ebner minor salivary protein, U46068
MMRRC Submission 042028-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4745 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 154190818-154220369 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 154211581 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 248 (K248*)
Ref Sequence ENSEMBL: ENSMUSP00000080501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028987] [ENSMUST00000081816]
AlphaFold Q61114
Predicted Effect probably null
Transcript: ENSMUST00000028987
AA Change: K248*
SMART Domains Protein: ENSMUSP00000028987
Gene: ENSMUSG00000027485
AA Change: K248*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
BPI1 36 256 3.3e-40 SMART
Pfam:LBP_BPI_CETP_C 331 470 1.6e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000081816
AA Change: K248*
SMART Domains Protein: ENSMUSP00000080501
Gene: ENSMUSG00000027485
AA Change: K248*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
BPI1 36 256 3.3e-40 SMART
Pfam:LBP_BPI_CETP_C 331 470 1.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123017
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may be involved in the innate immune response to bacterial exposure in the mouth, nasal cavities, and lungs. The encoded protein is secreted and is a member of the BPI/LBP/PLUNC protein superfamily. This gene is found with other members of the superfamily in a cluster on chromosome 20. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit strain background sensitive transmission ratio distortion and increased basal MUC5B production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,307,453 Y619C probably damaging Het
Adck1 A G 12: 88,402,179 probably null Het
Agap3 A C 5: 24,451,125 probably null Het
Ankib1 A T 5: 3,732,566 H354Q probably damaging Het
Ankrd29 T G 18: 12,254,622 N301T probably benign Het
Arhgef4 A G 1: 34,807,275 T379A probably damaging Het
Arid1a A G 4: 133,753,106 V169A probably benign Het
Armc4 G A 18: 7,286,763 T156M probably benign Het
Bag2 T C 1: 33,748,336 probably null Het
Bmt2 A C 6: 13,628,687 Y332* probably null Het
Caap1 C A 4: 94,556,514 probably null Het
Calcr T A 6: 3,692,576 Y389F probably damaging Het
Capn1 C T 19: 5,993,916 V562I probably benign Het
Ccr1 T A 9: 123,963,948 T182S probably benign Het
Ceacam15 T C 7: 16,673,334 D86G probably benign Het
Cldnd1 C T 16: 58,729,643 T63I probably benign Het
Col12a1 A T 9: 79,652,086 probably null Het
Cystm1 A G 18: 36,393,295 probably benign Het
Ddx55 T A 5: 124,566,965 Y428* probably null Het
Ensa G A 3: 95,631,434 G118D probably benign Het
Fam208b G A 13: 3,590,069 T356I probably benign Het
Folh1 A T 7: 86,723,274 probably null Het
Foxj2 C A 6: 122,837,989 P328Q probably damaging Het
Fscn3 A G 6: 28,435,628 I417V probably damaging Het
Galnt7 T C 8: 57,542,727 probably benign Het
Gm11563 T A 11: 99,658,420 *169C probably null Het
Hfm1 A T 5: 106,901,843 D417E possibly damaging Het
Ighv15-2 A G 12: 114,564,610 S107P probably damaging Het
Itsn2 A G 12: 4,661,944 D904G probably damaging Het
Kif1b A T 4: 149,237,882 L860* probably null Het
Krt79 T C 15: 101,930,684 E450G probably damaging Het
Lama1 T C 17: 67,738,780 S227P probably damaging Het
Lamp5 C A 2: 136,060,866 H168Q probably benign Het
Lilra5 A T 7: 4,242,077 Q240L possibly damaging Het
Lrp1 A T 10: 127,549,944 C3521S probably benign Het
Mroh1 T A 15: 76,408,530 probably null Het
Nlrp4g A T 9: 124,349,515 noncoding transcript Het
Nr2f6 A T 8: 71,378,535 I70N probably benign Het
Nr4a2 T A 2: 57,110,151 D311V probably damaging Het
Olfr1490 T A 19: 13,655,386 M319K probably benign Het
Olfr248 T C 1: 174,391,876 L269P probably damaging Het
Olfr659 T A 7: 104,671,504 F267L probably damaging Het
Pcdhb6 C A 18: 37,335,373 A449D possibly damaging Het
Pcgf6 A G 19: 47,048,106 probably null Het
Prc1 C A 7: 80,313,163 H131Q probably benign Het
Ptprq C A 10: 107,524,253 R2187L probably damaging Het
Rasl2-9 C A 7: 5,125,703 R76L possibly damaging Het
Rdh16f1 A T 10: 127,790,816 Y246F probably benign Het
Rit1 T C 3: 88,717,675 probably benign Het
Sash1 A G 10: 8,729,908 V906A probably benign Het
Scnn1b T C 7: 121,902,286 V108A probably benign Het
Sema4f A T 6: 82,918,284 I356N probably damaging Het
Shc4 A T 2: 125,649,277 L447Q probably damaging Het
Slc24a1 T C 9: 64,949,476 M50V unknown Het
Slc28a3 T A 13: 58,574,263 D269V possibly damaging Het
Slc35e1 A G 8: 72,492,322 S89P possibly damaging Het
Smpd5 T A 15: 76,294,808 H125Q probably benign Het
Snapc2 A G 8: 4,254,578 T31A probably damaging Het
Sox5 G C 6: 143,833,488 H606D possibly damaging Het
Spag6 A G 2: 18,737,296 T367A possibly damaging Het
Spag8 T C 4: 43,651,636 T413A probably damaging Het
Sptlc3 G A 2: 139,547,167 G156R probably damaging Het
Stx19 A G 16: 62,822,420 T200A probably benign Het
Tas2r116 A G 6: 132,855,705 T90A probably benign Het
Tbl3 A G 17: 24,705,330 probably benign Het
Tekt5 G T 16: 10,395,194 P76T probably damaging Het
Tjp2 C T 19: 24,096,666 E1086K possibly damaging Het
Topbp1 T C 9: 103,323,571 L601P probably damaging Het
Trav16 T A 14: 53,743,477 M41K possibly damaging Het
Trav6-5 C A 14: 53,491,503 N72K probably benign Het
Trpm3 C G 19: 22,715,295 T250S possibly damaging Het
Vps35 A T 8: 85,261,262 D753E probably benign Het
Vstm2a A T 11: 16,263,061 N149Y probably damaging Het
Vwa2 G T 19: 56,906,886 M497I probably benign Het
Zfat C A 15: 68,180,374 V517L probably benign Het
Zfp169 C A 13: 48,490,232 R473L possibly damaging Het
Zfp672 T C 11: 58,329,498 probably benign Het
Zranb1 T C 7: 132,972,714 V420A probably damaging Het
Other mutations in Bpifb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Bpifb1 APN 2 154217167 splice site probably benign
IGL01516:Bpifb1 APN 2 154218252 missense probably benign 0.03
IGL02047:Bpifb1 APN 2 154202616 start codon destroyed probably null 1.00
IGL02143:Bpifb1 APN 2 154209929 missense probably benign 0.14
IGL03174:Bpifb1 APN 2 154213049 missense probably damaging 1.00
IGL03263:Bpifb1 APN 2 154215306 missense probably benign 0.03
Ectoplasm UTSW 2 154211581 nonsense probably null
R0058:Bpifb1 UTSW 2 154206540 missense possibly damaging 0.54
R0269:Bpifb1 UTSW 2 154212947 missense possibly damaging 0.51
R0617:Bpifb1 UTSW 2 154212947 missense possibly damaging 0.51
R0786:Bpifb1 UTSW 2 154202661 missense probably benign 0.11
R1718:Bpifb1 UTSW 2 154213983 splice site probably null
R3605:Bpifb1 UTSW 2 154211565 missense possibly damaging 0.78
R3607:Bpifb1 UTSW 2 154211565 missense possibly damaging 0.78
R3689:Bpifb1 UTSW 2 154209899 missense probably benign 0.42
R3807:Bpifb1 UTSW 2 154214002 missense probably benign 0.25
R3930:Bpifb1 UTSW 2 154215322 missense possibly damaging 0.89
R4024:Bpifb1 UTSW 2 154213046 missense probably damaging 1.00
R4752:Bpifb1 UTSW 2 154216280 intron probably benign
R5505:Bpifb1 UTSW 2 154204779 missense probably benign 0.00
R5724:Bpifb1 UTSW 2 154204792 missense probably benign
R6281:Bpifb1 UTSW 2 154206465 missense probably damaging 1.00
R7038:Bpifb1 UTSW 2 154202669 missense probably damaging 0.99
R7246:Bpifb1 UTSW 2 154207092 missense probably damaging 1.00
R7540:Bpifb1 UTSW 2 154213111 missense probably damaging 1.00
R7599:Bpifb1 UTSW 2 154214151 missense probably damaging 1.00
R7678:Bpifb1 UTSW 2 154202729 missense possibly damaging 0.74
R7811:Bpifb1 UTSW 2 154206564 splice site probably null
R9031:Bpifb1 UTSW 2 154209928 missense probably benign 0.00
R9120:Bpifb1 UTSW 2 154204772 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGGCAGTGTCTTTAATGGCC -3'
(R):5'- TTGGGCAGAGAAAGACCCTG -3'

Sequencing Primer
(F):5'- CAGTGTCTTTAATGGCCAGAAAG -3'
(R):5'- ATGCACACACAGGGTCG -3'
Posted On 2016-08-18